ID: 1174002203

View in Genome Browser
Species Human (GRCh38)
Location 20:47383034-47383056
Sequence TGAGTGGCCCACTGCAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174002200_1174002203 10 Left 1174002200 20:47383001-47383023 CCTACTTTCAGGAGAGGCAGGTC No data
Right 1174002203 20:47383034-47383056 TGAGTGGCCCACTGCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174002203 Original CRISPR TGAGTGGCCCACTGCAGAAG AGG Intergenic
No off target data available for this crispr