ID: 1174003519

View in Genome Browser
Species Human (GRCh38)
Location 20:47392082-47392104
Sequence AGAGTCACTCCAGCTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174003511_1174003519 30 Left 1174003511 20:47392029-47392051 CCTATCTTGTTGCTCAGTGTCCT 0: 1
1: 0
2: 2
3: 11
4: 237
Right 1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 202
1174003513_1174003519 10 Left 1174003513 20:47392049-47392071 CCTCAACACATGGCTTCCACCTT 0: 1
1: 0
2: 5
3: 41
4: 330
Right 1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 202
1174003517_1174003519 -9 Left 1174003517 20:47392068-47392090 CCTTAGGGACCAAGAGAGTCACT 0: 1
1: 0
2: 1
3: 10
4: 131
Right 1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 202
1174003516_1174003519 -6 Left 1174003516 20:47392065-47392087 CCACCTTAGGGACCAAGAGAGTC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG 0: 1
1: 0
2: 0
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174003519 Original CRISPR AGAGTCACTCCAGCTCCTGC AGG Intergenic
901235304 1:7664439-7664461 AGAGTCACTCAGGCTGCTGTGGG - Exonic
901720803 1:11195691-11195713 AGACTCTGTCCACCTCCTGCTGG - Exonic
901916752 1:12505994-12506016 AGTGGCAGTCGAGCTCCTGCTGG - Intronic
902118624 1:14142729-14142751 AGAGGCCCTCCAGCTGCAGCGGG - Intergenic
902359527 1:15934845-15934867 AAAGGCCCTCAAGCTCCTGCAGG + Exonic
904181487 1:28669213-28669235 GGAGTCACTCCGGCCCCTCCTGG - Intronic
906144236 1:43550434-43550456 AGTGCCCCTCCAGCTCCTGCCGG - Intronic
913451454 1:118995420-118995442 AGAGTCCCTTGAGCTGCTGCTGG + Intergenic
913499822 1:119461958-119461980 AGAGTCTCCCCAGCACCTGAGGG + Intergenic
915603005 1:156934094-156934116 ATGGTCACCCCAGCTTCTGCAGG + Intergenic
917005838 1:170416318-170416340 AGAACCAATACAGCTCCTGCAGG + Intergenic
917170231 1:172164768-172164790 ATAGCCACTCCTGCTCCTGGAGG + Intronic
919728663 1:200899561-200899583 AGAGTCTCCTCAGCTCCTCCAGG - Exonic
1063113725 10:3058100-3058122 CCAGTCACTCCTCCTCCTGCAGG + Intergenic
1064006830 10:11705435-11705457 AGAATCCCTCCAGCTGCGGCAGG - Intergenic
1065887582 10:30092353-30092375 TGTGTAACTCCAGCTCCTCCTGG + Intronic
1065967516 10:30781643-30781665 CGAGGCACTCCGGATCCTGCAGG - Intergenic
1066660046 10:37729314-37729336 AGAGACACTCCAGATTCTGCAGG - Intergenic
1071168768 10:82838007-82838029 AGCATCACTCCTGCTCCTCCTGG - Intronic
1074146393 10:110720771-110720793 ACGGTCACTCCAGCTGCTGTGGG - Intronic
1075241688 10:120785216-120785238 AGAGTTTATCCACCTCCTGCAGG + Intergenic
1075864821 10:125708784-125708806 AGAGTCAGTCCAGTCCCTCCAGG - Intergenic
1077410907 11:2403464-2403486 ACAGTGCCTCCACCTCCTGCAGG - Exonic
1078007354 11:7541988-7542010 TGAGTCACTTCATCTCTTGCCGG + Intronic
1078767341 11:14311394-14311416 AGAGTCTCTCCAGCCCAGGCTGG + Intronic
1079278124 11:19060701-19060723 GGTTTCACTCCAGATCCTGCAGG - Intergenic
1079893401 11:26087666-26087688 AGAGGCACTCCAGCTGTAGCTGG - Intergenic
1080638032 11:34140407-34140429 AGAGTGCTTCCAGCTCCTCCCGG - Exonic
1084275864 11:68050611-68050633 AGAGTCCCTCCATCACCAGCAGG - Exonic
1084660901 11:70545744-70545766 AGAGTCAGTGCAGACCCTGCGGG + Intronic
1085341735 11:75735913-75735935 AGAGTCCCTTCAACCCCTGCTGG + Intergenic
1087218210 11:95517773-95517795 AGAAACACTCCAGCACCTGGAGG + Intergenic
1087814843 11:102647299-102647321 AGACTCACCCCATATCCTGCTGG - Intergenic
1089015690 11:115163425-115163447 AGAGTTACTCCAGATCCTGGAGG + Intergenic
1089559708 11:119337721-119337743 AGACACACACCAGCTCCTCCTGG - Intergenic
1089671199 11:120058127-120058149 AGAGGCCCTCTAGCTTCTGCGGG - Intergenic
1090629362 11:128632877-128632899 AGGGTGACTGGAGCTCCTGCGGG + Intergenic
1090802009 11:130178891-130178913 ATACACACTCCAGCTCCTCCTGG - Intronic
1094662011 12:32478868-32478890 AGAATCCTTCCAGCTCCTTCTGG + Intronic
1095130891 12:38541034-38541056 TGAGTCACCCCAGCTCCTCAGGG + Intergenic
1096810323 12:54165207-54165229 GCAGTCACACCAGGTCCTGCTGG - Intronic
1098042680 12:66368224-66368246 AAAAACACTCCAGCTCCTGCAGG - Intronic
1100931066 12:99609977-99609999 TGACTCACTCCAGTGCCTGCAGG - Intronic
1102220601 12:111191823-111191845 AGTGTCACCCCACCTCCTTCGGG + Intronic
1102419855 12:112794889-112794911 AGTGTCTCTCCAGCCCGTGCTGG + Intronic
1102985524 12:117274738-117274760 AGTGTCACTCCAGCCCAGGCTGG - Intronic
1104635919 12:130437797-130437819 CAAGTCACCCCTGCTCCTGCAGG + Intronic
1104969091 12:132523141-132523163 CTTGTCCCTCCAGCTCCTGCTGG + Intronic
1108453704 13:50591977-50591999 AGAGTAACTCCTAGTCCTGCAGG - Intronic
1110843993 13:80173268-80173290 AGATTCACTCCACCTTCTCCTGG - Intergenic
1110880956 13:80571700-80571722 ACAGTCACTCCAGCAACAGCTGG - Intergenic
1111645978 13:91032426-91032448 AGACAAACTGCAGCTCCTGCTGG + Intergenic
1113571403 13:111360934-111360956 AGAGGGACCCCAGCTCCTGGTGG - Intergenic
1114227675 14:20753737-20753759 GGAGCCACTTCAGCTCCAGCAGG + Intergenic
1114674136 14:24429902-24429924 GGAGTCAGCCCAGCTCCTCCCGG - Intronic
1117390649 14:55259152-55259174 AGATTCACTCCAGCACATTCAGG + Intergenic
1117462928 14:55964190-55964212 ACACAGACTCCAGCTCCTGCTGG - Intergenic
1118693291 14:68360495-68360517 AGAGTCATTACTGCTGCTGCTGG - Intronic
1120375828 14:83706056-83706078 TAAGTCACTCCAGCTCCTGTGGG - Intergenic
1120765331 14:88323188-88323210 AGTGTCACTCCAGCCCCCGAAGG + Exonic
1121581732 14:95037071-95037093 AGGCTCACTCCAGAGCCTGCAGG + Intergenic
1121891204 14:97592841-97592863 AGAGACACTCCCGCCCTTGCTGG + Intergenic
1124271921 15:28290026-28290048 AGAGTCTGTGCAACTCCTGCAGG - Intronic
1125127502 15:36241334-36241356 AAAGTCACTCCAGCTGCTCCAGG + Intergenic
1127358682 15:58226206-58226228 AGAGCTACTCTGGCTCCTGCAGG - Intronic
1128306746 15:66603859-66603881 AGAGTCTCTCCTGCCCCTCCTGG - Intronic
1132831879 16:1932448-1932470 AGAGCCACTGCTCCTCCTGCAGG + Intergenic
1134020116 16:10915636-10915658 ATACTCACTCCAGATGCTGCAGG - Exonic
1139169684 16:64615546-64615568 AGAGTTACTGGAGATCCTGCAGG + Intergenic
1139432405 16:66918199-66918221 TGAGGCTCTCCATCTCCTGCAGG + Intronic
1139477539 16:67210148-67210170 CGAGGCTCTGCAGCTCCTGCAGG + Exonic
1139924819 16:70480287-70480309 AAAGTCACTTTTGCTCCTGCTGG + Intergenic
1142026462 16:87816744-87816766 AGAGGCACAGCTGCTCCTGCCGG + Intergenic
1142172590 16:88630686-88630708 GGCGTCACTACAGCTCCTGCTGG + Intronic
1143990363 17:10954467-10954489 AGTGTGACTCCAGCTCAGGCAGG - Intergenic
1144848918 17:18234266-18234288 ATAGGCTCTCCAGCTGCTGCGGG - Exonic
1146943637 17:36860057-36860079 GAAGTCACTCCACCTCCTGGTGG - Intergenic
1148063633 17:44853222-44853244 AGAGTCACCTCGGCTCCTACAGG - Intronic
1148161579 17:45453297-45453319 AGCCTCACTCCACCTCCTGCTGG - Intronic
1149702668 17:58668390-58668412 ATAGTTACTGCAGCTCCTCCAGG - Intronic
1150392815 17:64799942-64799964 AGCCTCACTCCGCCTCCTGCTGG - Intergenic
1152077098 17:78166539-78166561 AGAGGCACCCCACCTCCTGGTGG + Intergenic
1152626849 17:81391726-81391748 GAAGTGACTCCAGATCCTGCTGG + Intergenic
1153621053 18:6978211-6978233 AGAGACACACCAGCTTCTGCAGG - Exonic
1153797744 18:8640417-8640439 TGGGTCATTCCAGCCCCTGCTGG + Intergenic
1154980555 18:21499497-21499519 AGAAGCACCCCATCTCCTGCTGG + Intronic
1157437726 18:47685238-47685260 GCAGTCACTCCTGTTCCTGCTGG - Intergenic
1157443077 18:47724900-47724922 TGGGGCACTGCAGCTCCTGCTGG + Intergenic
1158227895 18:55219379-55219401 AGAGACACTGCAGCTGCTTCCGG - Intergenic
1158383779 18:56966126-56966148 GGAGAGACTCCAGCTCCTACAGG + Intronic
1158973107 18:62686591-62686613 AGAGCAACTCCACCTTCTGCAGG - Intergenic
1160083461 18:75753096-75753118 CCAGGCACTCCAGCTGCTGCGGG + Intergenic
1160893278 19:1390727-1390749 AGAGGCACAGCGGCTCCTGCAGG - Intronic
1162868779 19:13569803-13569825 AAAGTCTCTCCAGATCATGCAGG - Intronic
1163347055 19:16749929-16749951 CGAGTCTCTCGTGCTCCTGCTGG + Exonic
1163690388 19:18735446-18735468 AGGCGCACGCCAGCTCCTGCAGG + Intronic
1163790484 19:19303251-19303273 AGTGCCACTCCAGCACCTCCAGG + Intronic
1164934685 19:32201608-32201630 GGGGCCACTCCAGCTGCTGCAGG + Intergenic
1165779000 19:38421253-38421275 AGCGTAGCTCCAGATCCTGCCGG + Intronic
1165797881 19:38529140-38529162 AGAGGCCCTCCAGGTCCTGGGGG + Intronic
1166748729 19:45154501-45154523 AGAGTCCCTACTCCTCCTGCTGG - Intronic
925212632 2:2063007-2063029 AGGGTCTGTCCAGCTCCCGCAGG - Intronic
925294314 2:2767518-2767540 AATGTCATTCCATCTCCTGCAGG + Intergenic
926069426 2:9873905-9873927 AAGGTCACTCCAGCTGCTGAGGG - Intronic
928937634 2:36695959-36695981 AGAGTCATTCCTCCTCCTGCTGG - Intergenic
930562266 2:52974554-52974576 AGAGACACTCCATCTCTTGAAGG + Intergenic
931213034 2:60215463-60215485 AGGCCCACTTCAGCTCCTGCTGG - Intergenic
933992767 2:87645418-87645440 CGACTCACTGCAGCTCCAGCTGG - Intergenic
934531353 2:95091220-95091242 AGAGACACGCCACCTCCTGCTGG + Intronic
936248833 2:110851915-110851937 GGGGTCACTCCAGCTCCCACTGG + Intronic
936301089 2:111305423-111305445 CGACTCACTGCAGCTCCAGCTGG + Intergenic
936669954 2:114645672-114645694 AGAGTCACCCCAGCTCTGCCAGG - Intronic
938730001 2:134140063-134140085 AGTGCCTCTCCAGGTCCTGCTGG - Intronic
939008954 2:136822377-136822399 AGACTGACTCCTGCTGCTGCTGG + Intronic
949075784 2:242056941-242056963 AGAGCCTCTCCAGGTCCTTCGGG - Intergenic
1169276014 20:4234202-4234224 AGCGTCCCAGCAGCTCCTGCAGG - Intronic
1171322267 20:24256584-24256606 TCAGTCACTTAAGCTCCTGCAGG - Intergenic
1171382732 20:24745793-24745815 AGACTCACTCCAGGACCTCCAGG + Intergenic
1173082922 20:39886936-39886958 ACAATCACTCCAGCTTCAGCTGG + Intergenic
1174003519 20:47392082-47392104 AGAGTCACTCCAGCTCCTGCAGG + Intergenic
1174316329 20:49705088-49705110 AGGAGCATTCCAGCTCCTGCTGG - Intronic
1175259838 20:57667496-57667518 AGAGTCCACCCGGCTCCTGCCGG + Intronic
1175517082 20:59576815-59576837 AGAGTCACCCCAACCCCTTCAGG + Intergenic
1175734910 20:61378456-61378478 TGGGTTTCTCCAGCTCCTGCTGG + Intronic
1176023837 20:62975938-62975960 AGAGGCAGTCCTGCGCCTGCTGG - Intergenic
1176258743 20:64167698-64167720 AGAGCCCCCCCAGCCCCTGCGGG - Intronic
1178453716 21:32728002-32728024 AGCGTCACTTCCGCTCCAGCAGG + Exonic
1179380787 21:40897357-40897379 CCAGTCACTCCAGCTGCAGCTGG + Intergenic
1179418267 21:41215561-41215583 AGACTCCATCCAGCTTCTGCTGG + Intronic
1180119238 21:45735725-45735747 ACTGGCCCTCCAGCTCCTGCTGG - Intronic
1181267794 22:21641353-21641375 AGCTTCACTCCAGATCCTGTGGG - Intergenic
1181429098 22:22866908-22866930 AGCCACTCTCCAGCTCCTGCCGG - Intronic
1183123291 22:35749117-35749139 AGATTCTCTCCATCTCCTTCTGG - Intronic
1183230582 22:36579557-36579579 AGTATCACTCCAGCTTCTGCAGG - Intronic
1184935635 22:47718374-47718396 AGAGTCCCTGGAGCTCCTTCCGG - Intergenic
1185322205 22:50206808-50206830 TGAGACACACCAGCTCCCGCAGG - Intronic
949697250 3:6713280-6713302 AGAGTTACTCCTGTTCCTGTTGG + Intergenic
950152308 3:10697229-10697251 TCAGTCACTCCACCACCTGCTGG + Intronic
950708522 3:14798682-14798704 AAGGTCTCTCCAGCTCCAGCAGG + Intergenic
953410712 3:42689114-42689136 ACAGGGACTGCAGCTCCTGCTGG - Intronic
954148571 3:48646392-48646414 AGAATCCCTCCAGCTTCTGCTGG + Intronic
955610757 3:60754395-60754417 AAAGACACTCCATATCCTGCAGG - Intronic
956124270 3:65996721-65996743 ATAGACACTCCAGCTTGTGCTGG + Intronic
956731825 3:72203668-72203690 AGAGGAACTGCAGCTGCTGCCGG + Intergenic
958432170 3:94054140-94054162 AGAGTCACTGCAGCTTCTGATGG - Exonic
960987852 3:123292244-123292266 AGAGTCAGTCCTGGTCCTGTTGG - Intronic
963980024 3:151527257-151527279 AGAGTGAATCCAGCTCCCGCTGG - Intergenic
967828951 3:193902469-193902491 AGCCTCCCTCCTGCTCCTGCTGG + Intergenic
971774940 4:30950994-30951016 CGAGTCCTCCCAGCTCCTGCAGG + Intronic
972773093 4:42216519-42216541 AGAGTCATGCCAGGTCTTGCAGG - Intergenic
975711764 4:77167941-77167963 AGACTCTCTTTAGCTCCTGCAGG + Exonic
978284912 4:107065057-107065079 AGAGTCACTCCAGATTGTGTTGG - Intronic
978833219 4:113114855-113114877 AGGGTGACTCCAGCTTCTTCTGG - Intronic
980990663 4:139735777-139735799 AGAGGCAGTCTAGGTCCTGCCGG - Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
986197304 5:5549757-5549779 AGAGCCCCTGCAGCCCCTGCAGG - Intergenic
987834681 5:23146136-23146158 AGAGTTACTGGAGATCCTGCAGG + Intergenic
988475373 5:31580281-31580303 AGGGTCACTCTTGCTCTTGCTGG + Intergenic
990444972 5:55885961-55885983 AGAGTTACTACAGCTGCTGGGGG + Intronic
992613023 5:78523710-78523732 AGACTGACTTCAGTTCCTGCTGG - Intronic
995526991 5:113058260-113058282 AGTATCACTTCAGTTCCTGCAGG - Intronic
997735464 5:136209553-136209575 AGCGTTACCCAAGCTCCTGCTGG + Intergenic
998507961 5:142687070-142687092 AGAGTCGCTCCTGCTTATGCAGG + Intronic
1002872156 6:1176929-1176951 GGAGTCACTCCAGCTTCTCCTGG + Intergenic
1002924361 6:1596212-1596234 AGCGTGACTCCAGCTCATGAGGG - Intergenic
1003992411 6:11499196-11499218 AGAGTCCATCCACTTCCTGCTGG + Intergenic
1005112212 6:22294564-22294586 AGGGTCCCTCCTGCTGCTGCTGG - Exonic
1008207083 6:48674057-48674079 AGAGTCACAGCAGCTACTTCTGG - Intergenic
1008885336 6:56426177-56426199 AGAGACACTAAAGCACCTGCAGG + Intergenic
1010153667 6:72766430-72766452 ATAATCACTCCAGCTACTGTGGG + Intronic
1013752019 6:113417854-113417876 AGAATGAGTCCAGCTTCTGCAGG + Intergenic
1014446665 6:121535843-121535865 ACAGCATCTCCAGCTCCTGCTGG - Intergenic
1016893698 6:149032382-149032404 GGGCTCACACCAGCTCCTGCTGG + Intronic
1016902741 6:149118162-149118184 AGAGTCACATCAGCTCCAGGTGG + Intergenic
1018731709 6:166656551-166656573 AGAGTCACGGGAGCACCTGCCGG - Intronic
1018802966 6:167237644-167237666 AGAGTCACAGCAGCTCCCGTGGG + Intergenic
1019308687 7:348372-348394 AGAATCCCTCCAGTCCCTGCTGG + Intergenic
1020369225 7:7414431-7414453 AGTGGAACTCCAGCTCCTTCAGG - Intronic
1020369852 7:7419916-7419938 AGAGGCCCTCCAGGTCCTTCTGG - Exonic
1022727274 7:32992396-32992418 AGAAACTCTGCAGCTCCTGCTGG - Intronic
1023365842 7:39462437-39462459 GGAGTCACTGCAGCTCATGAGGG - Intronic
1024249300 7:47494297-47494319 TGGGCCACTCCAGCTCTTGCTGG + Intronic
1024399818 7:48911280-48911302 AGAGGCACCCAAGCTCCTGCTGG + Intergenic
1024428293 7:49255409-49255431 AAAATCACTCCAGCACCTGAGGG - Intergenic
1025046309 7:55695253-55695275 AGAAACTCTGCAGCTCCTGCTGG + Intergenic
1026105490 7:67417663-67417685 AAAGTCTCTCCAGCTCTTGCTGG + Intergenic
1029216125 7:98951400-98951422 GGAGTCACAGCAGCTACTGCAGG - Intronic
1029333222 7:99877875-99877897 AGAGGCGCCCCAGCTTCTGCAGG - Intronic
1030005876 7:105119130-105119152 AGAGGCATTCAAGCACCTGCAGG + Intronic
1031350496 7:120724608-120724630 AGTGTCTCTCCATCACCTGCAGG - Intronic
1032942305 7:136809302-136809324 AGAGTGAGACCGGCTCCTGCTGG + Intergenic
1033221648 7:139530473-139530495 AGATTCTCTCCAGCTCTGGCAGG + Intronic
1035039745 7:155919353-155919375 AGTGACACTCCATCTCCCGCGGG - Intergenic
1036467789 8:9017766-9017788 AGAGGCAATCCAGATCCTGAAGG + Intronic
1037582301 8:20252874-20252896 TGAGGCTCTCGAGCTCCTGCCGG + Exonic
1037583927 8:20263581-20263603 ATGGTCTCTCCAGCTCCTGAAGG - Intronic
1038899797 8:31829701-31829723 AGAGCCACTCAACCTGCTGCAGG - Intronic
1039471263 8:37815054-37815076 TGAGTGACTCCAGAACCTGCCGG + Intronic
1039841924 8:41299973-41299995 ACAGTCACTGCGGCACCTGCAGG - Intronic
1043384254 8:79732407-79732429 CCAGCCACTCCAGCTCCAGCTGG - Intergenic
1044873376 8:96641876-96641898 GGAGTGACTGAAGCTCCTGCAGG + Intergenic
1045227575 8:100264673-100264695 ACAGTCACTGCAGCTACTACTGG + Exonic
1046396977 8:113653412-113653434 AGAGGCACCCAAGCTCCAGCTGG - Intergenic
1046632114 8:116631488-116631510 AGAGGGACTCGAGGTCCTGCTGG - Intergenic
1046819773 8:118622083-118622105 AGAGCAACTCCAGCTTCAGCTGG + Intergenic
1049701151 8:144013363-144013385 AGATCCCCTCCAGATCCTGCAGG + Intronic
1055156188 9:73065785-73065807 TGAGCCACTTCAGTTCCTGCTGG + Intronic
1055325151 9:75120942-75120964 AGAGGCAGTCCACCTCCAGCTGG - Intronic
1055945164 9:81687347-81687369 AGAGGAATTCCAGTTCCTGCAGG - Exonic
1056706128 9:88953970-88953992 TGGGAGACTCCAGCTCCTGCAGG + Intergenic
1057294006 9:93824919-93824941 GGAGTCCAGCCAGCTCCTGCTGG - Intergenic
1057788328 9:98105167-98105189 TCAGTCCCTACAGCTCCTGCGGG + Intronic
1058600866 9:106668690-106668712 ACAGTCACCACTGCTCCTGCTGG - Intergenic
1059337532 9:113578620-113578642 AGCGTCAGCCCAGCTCCTCCAGG - Intronic
1060269298 9:122129534-122129556 CCAGTCACTCCACCTCCTGCAGG + Intergenic
1061825005 9:133252486-133252508 AGAGTCACTCCAGTCCCTCTGGG + Intronic
1062577077 9:137213864-137213886 AGACTCACCCCAGCTCATGCTGG - Exonic
1189279132 X:39808973-39808995 GGAGTCACTCAAGCACCTGGAGG - Intergenic
1189421267 X:40860383-40860405 GAAGACACTCCTGCTCCTGCTGG + Intergenic
1191830355 X:65408172-65408194 AGAGGAATTCCAGTTCCTGCAGG + Intronic
1197602129 X:128543327-128543349 AGAGTTATTGGAGCTCCTGCAGG + Intergenic
1198085729 X:133279786-133279808 AGAGCCACTCCAGACCCTGTTGG - Intergenic