ID: 1174008754

View in Genome Browser
Species Human (GRCh38)
Location 20:47431788-47431810
Sequence GGTGCCCAGCTTGCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174008751_1174008754 -8 Left 1174008751 20:47431773-47431795 CCAGGCATGAGCCATGGTGCCCA No data
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data
1174008748_1174008754 9 Left 1174008748 20:47431756-47431778 CCCAAAGTGCTGGGATTCCAGGC 0: 1140
1: 222056
2: 272929
3: 184924
4: 143107
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data
1174008742_1174008754 22 Left 1174008742 20:47431743-47431765 CCTGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data
1174008749_1174008754 8 Left 1174008749 20:47431757-47431779 CCAAAGTGCTGGGATTCCAGGCA 0: 542
1: 93218
2: 232008
3: 241398
4: 215163
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data
1174008746_1174008754 12 Left 1174008746 20:47431753-47431775 CCTCCCAAAGTGCTGGGATTCCA 0: 1548
1: 296516
2: 266980
3: 155739
4: 134602
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data
1174008744_1174008754 18 Left 1174008744 20:47431747-47431769 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data
1174008741_1174008754 25 Left 1174008741 20:47431740-47431762 CCACCTGCCTTGGCCTCCCAAAG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
Right 1174008754 20:47431788-47431810 GGTGCCCAGCTTGCCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174008754 Original CRISPR GGTGCCCAGCTTGCCCAGGC TGG Intergenic
No off target data available for this crispr