ID: 1174021545

View in Genome Browser
Species Human (GRCh38)
Location 20:47534100-47534122
Sequence GTTTCAGTGGGGGGGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 788
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 716}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174021533_1174021545 -4 Left 1174021533 20:47534081-47534103 CCAACAGGATTTTGTGATGGTTT 0: 1
1: 0
2: 11
3: 48
4: 367
Right 1174021545 20:47534100-47534122 GTTTCAGTGGGGGGGGCGGGGGG 0: 1
1: 0
2: 3
3: 68
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174021545 Original CRISPR GTTTCAGTGGGGGGGGCGGG GGG Intronic
900109686 1:1000278-1000300 GTGTCGGAGGGGGGCGCGGGCGG - Intergenic
900174043 1:1284153-1284175 GGTTGAGTGAGGGGGGTGGGGGG + Intronic
900201040 1:1406705-1406727 GTGACAGTGGGGGTGGCGGCGGG + Intronic
900841105 1:5049304-5049326 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
901165466 1:7218465-7218487 GTTTTTGGGGGAGGGGCGGGAGG + Intronic
901179982 1:7335132-7335154 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
901619158 1:10568324-10568346 GTGGGAGTGGGGGGGGGGGGGGG - Intronic
901953099 1:12764129-12764151 GATTCATTGGGGGTGGGGGGAGG - Intergenic
902237448 1:15066660-15066682 TTTTCCATGGGGTGGGCGGGAGG + Intronic
902765024 1:18608178-18608200 TGTCCACTGGGGGGGGCGGGGGG + Intergenic
902970055 1:20041789-20041811 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
903462873 1:23531351-23531373 CTTTCCGGGGGGGGGGGGGGGGG - Intergenic
903622460 1:24707813-24707835 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
904181324 1:28668816-28668838 GTCTCCGTCGGGCGGGCGGGCGG - Exonic
904191245 1:28745718-28745740 TTTTGGGGGGGGGGGGCGGGGGG - Intronic
904517042 1:31064756-31064778 TTTTCAGCGGGGGGGGGGGGGGG + Intronic
904581537 1:31547696-31547718 GTTTCAGTGGCAAGGGCAGGTGG + Intergenic
905068347 1:35203835-35203857 GTCTTAGTGGGGGGGGGGGGGGG - Intergenic
905802524 1:40854318-40854340 ATTTTAGTGGGGGGCGGGGGCGG - Intergenic
905849068 1:41259487-41259509 GTTTGAGTGGTGGGGGTGGGTGG + Intergenic
906126723 1:43431529-43431551 GTTACAGTGTTGGGGGTGGGGGG - Intronic
906145660 1:43558695-43558717 GTCTCAGTGGCGGCAGCGGGCGG - Intronic
906459601 1:46027315-46027337 GTTTCAGGGAGAGGGGCAGGGGG - Intronic
906743658 1:48206617-48206639 GTTTGTGTGTGGGGGGAGGGGGG + Intergenic
907429491 1:54404009-54404031 GTTTTAGTGGGGGAGGGGGGCGG + Intronic
907538825 1:55193283-55193305 GTATCTGTGGGGAGGGCAGGTGG + Intronic
907819074 1:57949156-57949178 ATTTCCATGGGGGGGGCTGGGGG + Intronic
908548994 1:65190444-65190466 TTTTTTGGGGGGGGGGCGGGAGG + Intronic
910237275 1:85048538-85048560 GTTAAAGCGGCGGGGGCGGGAGG - Intronic
910438561 1:87229553-87229575 TTTTTGGTGGGGGGGGTGGGTGG - Intergenic
910498994 1:87867165-87867187 GTTGCTGGCGGGGGGGCGGGGGG - Intergenic
911698268 1:100919234-100919256 GTTTTTGTGGGTGGGGCGGTAGG + Intronic
912939211 1:114030308-114030330 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
913609997 1:120501761-120501783 GTGTCAGTGGGGTGGGGGGAGGG - Intergenic
913961252 1:143339578-143339600 GAGTCAGTGGGAGGGGCTGGCGG + Intergenic
914055605 1:144165151-144165173 GAGTCAGTGGGAGGGGCTGGCGG + Intergenic
914123541 1:144801211-144801233 GAGTCAGTGGGAGGGGCTGGCGG - Intergenic
914203811 1:145509378-145509400 GTGTCAGTGGGGTGGGGGGAGGG + Intergenic
914482934 1:148082532-148082554 GTGTCAGTGGGGTGGGGGGAGGG + Intergenic
914581191 1:149020481-149020503 GTGTCAGTGGGGTGGGGGGAGGG + Intronic
914835156 1:151200413-151200435 GTGTCGGGTGGGGGGGCGGGAGG + Intronic
915852699 1:159343045-159343067 GTGTGTGGGGGGGGGGCGGGCGG + Intergenic
916169272 1:161988537-161988559 GTGTCAGCGGGGGTGGGGGGTGG - Intronic
916329114 1:163595014-163595036 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
916494155 1:165329613-165329635 TTTGCAGTGGCGGGGGTGGGGGG - Intronic
917002042 1:170370990-170371012 GTTGCAGGGTGGGGGGAGGGAGG - Intergenic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917235972 1:172892325-172892347 GTTTAATTTGGGGTGGCGGGGGG + Intergenic
917864752 1:179183219-179183241 GACTCAGTGGGTGGGGCGGGAGG + Intronic
917873618 1:179265240-179265262 GTATCTTTGTGGGGGGCGGGGGG - Intergenic
917984519 1:180302032-180302054 GATTTATTGGGGGGGGAGGGTGG + Intronic
920426999 1:205886351-205886373 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
921264977 1:213414802-213414824 GTTTTAGTTGGGGGGCAGGGTGG + Intergenic
921409748 1:214823251-214823273 GTTCCAGTGGAGGTGGTGGGAGG + Intergenic
921680464 1:218025083-218025105 GTATCACTGTGGGGGGCGGGGGG - Intergenic
922434807 1:225593393-225593415 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
922567915 1:226612898-226612920 GTCTCGGTGGGGGGTGGGGGAGG + Intergenic
922769964 1:228176400-228176422 GTTTCATTTGGGGGAGAGGGAGG + Exonic
923401565 1:233619908-233619930 GTCTAAGCGAGGGGGGCGGGGGG + Intronic
923566857 1:235082937-235082959 TTTGCAGTGGGGGGTGGGGGTGG - Intergenic
923788515 1:237091421-237091443 TTTTTTTTGGGGGGGGCGGGGGG + Intronic
923792578 1:237124771-237124793 TTTTTGGTGGGGGGCGCGGGGGG + Intronic
923971350 1:239206282-239206304 GTTTCAGGGGAGGGGGTGGGGGG + Intergenic
924321365 1:242854540-242854562 GTTTCAGTGGAGGTGGCAGGGGG + Intergenic
1062831435 10:608418-608440 GTGTGTGTGGGGGGGGCTGGGGG - Intronic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1062831496 10:608551-608573 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1062832730 10:616951-616973 GTCTCAGTGGGGATGGGGGGTGG - Intronic
1063630930 10:7733132-7733154 GTTACAGTGGAGGAGGGGGGTGG - Intronic
1063661596 10:8037857-8037879 TTTTTGGGGGGGGGGGCGGGTGG + Intergenic
1064451340 10:15444844-15444866 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1064729641 10:18317107-18317129 TTTTCTGTGTGGGGGGCAGGGGG - Intronic
1065004463 10:21366656-21366678 ATTTCAGTGGGAGGGTGGGGAGG + Intergenic
1065099707 10:22321195-22321217 GTTGCTGTGGGGGAGGCGGGCGG - Exonic
1065185894 10:23171337-23171359 GTTTCCGTTGGGGGGATGGGGGG - Intergenic
1065437969 10:25721119-25721141 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1065513925 10:26506243-26506265 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
1065751908 10:28895399-28895421 TTTTTTTTGGGGGGGGCGGGGGG + Intergenic
1066144369 10:32541369-32541391 GTATCAATGGGAGGGGTGGGTGG + Intronic
1066365904 10:34776828-34776850 TTTTTTGTGGGGGGGGGGGGCGG + Intronic
1066440853 10:35437135-35437157 GTGTCAATGGTGGGGCCGGGTGG - Intronic
1066539437 10:36429319-36429341 GAAACAGTGGGGGTGGCGGGGGG - Intergenic
1067029704 10:42871977-42871999 GAGTCAGTGGGAGGGGCTGGCGG + Intergenic
1067127698 10:43533926-43533948 GTGTCAGGGGAGGGGCCGGGTGG + Intergenic
1067360669 10:45575281-45575303 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1067711571 10:48655249-48655271 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1067800273 10:49353805-49353827 GCTGCAGTGGAGGGGGCTGGAGG - Intergenic
1068687674 10:59885916-59885938 ATTCTAGTTGGGGGGGCGGGGGG - Intronic
1070094435 10:73323315-73323337 GTGTTAATGGCGGGGGCGGGGGG + Intronic
1070275750 10:75004869-75004891 TTTTCAGGGGGAGGGGTGGGGGG + Intronic
1070566867 10:77610285-77610307 GTTTCAGTGTGTGTGGTGGGGGG - Intronic
1070893780 10:79964466-79964488 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1071024139 10:81092621-81092643 GTTTCAGTGGAGGTGACAGGGGG + Intergenic
1071239313 10:83686752-83686774 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1071882588 10:89915703-89915725 TTTTCAGTGGATGGTGCGGGAGG + Intergenic
1071910688 10:90229603-90229625 GCTTCAGTGGAGGTGGCAGGGGG - Intergenic
1072214952 10:93280351-93280373 GAATCAGTGGAGGGGGCTGGGGG - Intergenic
1073012466 10:100372188-100372210 CTTTGAGAGGGTGGGGCGGGCGG - Intergenic
1073090006 10:100928032-100928054 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1073448647 10:103596152-103596174 GTTTCAGAGGGTGGGTCAGGTGG - Exonic
1073523721 10:104159612-104159634 GATTCAGTGGAGCTGGCGGGTGG + Intronic
1074422203 10:113319168-113319190 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1075788984 10:125069882-125069904 GTTTGTGTGGGGGGGGGAGGGGG - Intronic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076591611 10:131587441-131587463 GCTGCAGTGGAGGGGGCTGGTGG - Intergenic
1076896687 10:133316676-133316698 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1077118654 11:896822-896844 GTTTCTGTGGTGGAGGCTGGGGG - Intronic
1077130831 11:971577-971599 GGGTCAGTGGGGGTGGAGGGGGG + Intronic
1077248711 11:1551322-1551344 GGATGAGTGGGGTGGGCGGGTGG - Intergenic
1077248881 11:1551923-1551945 GGATGAGTGGGGTGGGCGGGTGG - Intergenic
1077475528 11:2788549-2788571 GGTTGGGTGTGGGGGGCGGGGGG - Intronic
1077492208 11:2866753-2866775 TTCTCAGTGAGGGGGGCGGGAGG + Intergenic
1077859263 11:6160493-6160515 GGTTCAGTGGGCGGGGGTGGGGG + Intergenic
1078009329 11:7559578-7559600 GTCTCACTGGGGGGTGAGGGAGG + Intronic
1081207163 11:40289832-40289854 GTTTAAGTGGAGGGGATGGGAGG + Intronic
1081652807 11:44835618-44835640 ATTTTACTGTGGGGGGCGGGGGG + Intronic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1082140441 11:48602950-48602972 GTTCCAGTGGAGGTGGCGGAGGG + Intergenic
1082197430 11:49322693-49322715 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1082567630 11:54700050-54700072 GTTCCAGTGGAGGTGGCGGAGGG + Intergenic
1082785260 11:57313180-57313202 GCTTCAGTGATGGGGGAGGGAGG + Exonic
1083193406 11:61068666-61068688 GTCGCAGTGGAGGGGGTGGGAGG - Intergenic
1083633148 11:64105964-64105986 GTATCTGTGGGGTGGGCGGGAGG + Intronic
1083920843 11:65780854-65780876 GTTTCGGTGCGGGCCGCGGGCGG - Intergenic
1084122569 11:67078004-67078026 GTCGGGGTGGGGGGGGCGGGAGG + Intergenic
1084123220 11:67081748-67081770 GGCTCAGTGGGTGGGGCTGGTGG - Intergenic
1084323171 11:68384777-68384799 GCTTCAGTTTGGGGGGTGGGGGG - Intronic
1085068213 11:73517530-73517552 GTTTCGGCGGGGGCGGGGGGTGG + Intronic
1085089727 11:73700602-73700624 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1085644523 11:78214374-78214396 GTTTTGGGGGGGGGGGCGGGGGG + Exonic
1085747871 11:79129988-79130010 GTTCCAGTGGAGGTGGCAGGGGG - Intronic
1086658386 11:89385431-89385453 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1086825383 11:91489591-91489613 GTTCCAGTGGAGGTGGCAGGGGG + Intergenic
1087197230 11:95313963-95313985 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1087901500 11:103646457-103646479 CTTTCTGTGGGGGGGGGGGGGGG + Intergenic
1087959237 11:104327024-104327046 TTTTTGTTGGGGGGGGCGGGGGG + Intergenic
1088239581 11:107759302-107759324 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1088406045 11:109480272-109480294 GTTTGAGCGGGGGGCGGGGGCGG - Intergenic
1088578724 11:111297334-111297356 CCTTCTGTGGAGGGGGCGGGTGG + Intergenic
1088731472 11:112687657-112687679 GTTTCAGTGGACAGGGCAGGAGG + Intergenic
1088996003 11:114997302-114997324 GTTTCACTGGGCTGGGCAGGAGG + Intergenic
1089043899 11:115481917-115481939 GTGTCAATGAGGGGAGCGGGAGG - Intronic
1089078611 11:115758957-115758979 ATCTCTGTGGGGGTGGCGGGGGG + Intergenic
1089619216 11:119713015-119713037 GAGTCAATGGGTGGGGCGGGTGG + Intronic
1089905268 11:122031720-122031742 GCTTGAGTGGGGAGGGTGGGTGG + Intergenic
1091817504 12:3451041-3451063 CTTTCGGCGGGGGGGGGGGGGGG - Intronic
1093010571 12:14102264-14102286 ATTTCAGTGGAGGTGGCAGGAGG - Intergenic
1093557818 12:20498268-20498290 CCTTCAGTTGGGGGGGTGGGCGG - Intronic
1094213146 12:27913496-27913518 GTTTGTGTGGTGGGGGTGGGGGG + Intergenic
1094501356 12:31023612-31023634 GTTTCAGTGGAGGTGGCGGAGGG - Intergenic
1095327695 12:40917045-40917067 ATACCAGTGGTGGGGGCGGGGGG + Intronic
1095987725 12:48010681-48010703 GCTCCAGTGCGGGGGGCGGGGGG + Intergenic
1096514516 12:52148612-52148634 GGTGCAGTGGGGTGAGCGGGCGG + Intergenic
1096647603 12:53047235-53047257 GTGGCAGTGGCGGGAGCGGGCGG - Intronic
1096906944 12:54944660-54944682 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1096989017 12:55783302-55783324 GTTTGAGGGGGGTGGGTGGGAGG + Intronic
1097295539 12:57958487-57958509 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1097592681 12:61591318-61591340 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1097877254 12:64654634-64654656 GTTTCTTTGCGGGGGGGGGGGGG + Intronic
1098674340 12:73269666-73269688 GTTGTGGTGTGGGGGGCGGGAGG + Intergenic
1098863997 12:75741544-75741566 GTTTTGGTGGGCGGGGAGGGGGG - Intergenic
1098920264 12:76296280-76296302 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1098960876 12:76738882-76738904 GTTCCAGTGGAGGTGGCGGAGGG + Intergenic
1099542629 12:83932134-83932156 GTGTGTGTGGGGGGGGGGGGCGG + Intergenic
1099576968 12:84393944-84393966 GTTCCGGGGGGGGGGGGGGGCGG - Intergenic
1100187116 12:92150528-92150550 GGTTCGGTGGGGGAGGTGGGAGG + Intergenic
1100196647 12:92253865-92253887 GTCAGAGTGTGGGGGGCGGGAGG - Intergenic
1100335613 12:93626333-93626355 GTTGCAGTGGGGGTAGAGGGAGG - Intergenic
1101049057 12:100842063-100842085 CTTTCAGTGGGGGGGGGGGGGGG - Intronic
1102121937 12:110448773-110448795 TTTTCCGGGGGGGGGGGGGGTGG + Intronic
1102332742 12:112048868-112048890 TTTTTATTTGGGGGGGCGGGGGG - Intronic
1102408017 12:112690997-112691019 ATTTCAGTGCGGGGGCGGGGGGG - Intronic
1102823484 12:115927277-115927299 GTTTCGGGGGAGGGGGTGGGGGG - Intergenic
1103120777 12:118377513-118377535 GTTTCCGGGAGGGGGGCGGGTGG - Intronic
1103152831 12:118656209-118656231 GTTTCAGTGGGGAGATGGGGAGG + Intergenic
1103297239 12:119898168-119898190 CTTTTTTTGGGGGGGGCGGGGGG + Intergenic
1103518163 12:121520821-121520843 GGTTCTGTGGCGGGGGAGGGGGG - Intronic
1103600697 12:122052860-122052882 TTTTTAGTCGGGGGGGGGGGGGG + Intronic
1103954451 12:124568418-124568440 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104281958 12:127386538-127386560 GTGGGAGTGGGGGGGGCTGGGGG + Intergenic
1104360558 12:128129147-128129169 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1104889487 12:132133317-132133339 GTTTGAGTGGGGGTGGCTGTGGG + Intergenic
1106023899 13:25939765-25939787 GTTTCAGTGGGGATGGTGGCAGG - Intronic
1106227933 13:27799045-27799067 GTGTGTGTGGGGGGGGGGGGTGG - Intergenic
1106604334 13:31213619-31213641 GTTTTGGCGGGGGGGGGGGGTGG - Intronic
1107484459 13:40813121-40813143 GTGTGGGTGGGGGGGGGGGGGGG - Intergenic
1107702414 13:43061253-43061275 GTTTCAGTGGGGGAGTGGGTGGG + Intronic
1107914078 13:45131497-45131519 GTTTCAGTGGAGTGGCAGGGAGG + Intronic
1107985009 13:45767975-45767997 GTGTGTGTGGTGGGGGCGGGGGG + Intergenic
1108300030 13:49064395-49064417 TTTTTTGGGGGGGGGGCGGGGGG - Intronic
1108465554 13:50711762-50711784 GACCCAGTGGCGGGGGCGGGGGG + Intronic
1108702958 13:52959198-52959220 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1110281507 13:73699185-73699207 ATTGCAGTGGGGGGGTGGGGGGG - Intronic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1110486629 13:76052001-76052023 GTTTCAGTGGGGTGTGTAGGGGG - Intergenic
1111037970 13:82704484-82704506 GTTTCTGTGTGGTGGGTGGGGGG - Intergenic
1111950394 13:94704871-94704893 GTGGCGGTGGGGGGGGTGGGGGG + Intergenic
1112015595 13:95328867-95328889 TTTTTAGTGGGGCGGGCGGGTGG + Intergenic
1112059432 13:95722825-95722847 TTTTCGGCGGGGGGGGGGGGGGG - Intronic
1113102105 13:106732225-106732247 GTGTCAGAGGGAGGGCCGGGTGG - Intergenic
1113231156 13:108215411-108215433 GTTGGGGTGGGGGGGGTGGGGGG - Intronic
1113389594 13:109882666-109882688 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1114494069 14:23120502-23120524 GGTCCAGTTGGGGGGGGGGGGGG + Intergenic
1114906700 14:27137286-27137308 GTTTATGTGGGGGGGGGGGGTGG + Intergenic
1114963087 14:27919613-27919635 GTTTTAGGGTGGGGGGAGGGGGG - Intergenic
1115005456 14:28477499-28477521 CTGTCAGTGGGTGGGGTGGGTGG - Intergenic
1115299300 14:31865898-31865920 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1115556896 14:34551188-34551210 GTCTCGGAGGGGGAGGCGGGGGG - Intergenic
1115850446 14:37585763-37585785 GTGTTGGGGGGGGGGGCGGGGGG + Intergenic
1115901667 14:38158039-38158061 GTCTCAGTGGGGGGCGGTGGTGG - Intergenic
1116335590 14:43652032-43652054 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1117029354 14:51652323-51652345 GCTTCAGCGGCGGGGGCGGGAGG + Intronic
1117033698 14:51704613-51704635 TTTTCAGTGAGGTGGGAGGGAGG + Intronic
1117106219 14:52399516-52399538 GTTTCAGTGGACGGAGGGGGAGG + Intergenic
1118159745 14:63276203-63276225 GCTTCGGTGGGGGGGGGCGGGGG + Intronic
1118262737 14:64262659-64262681 GTTTCGGCGGGTGGGGCGGGAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119140861 14:72265934-72265956 TTTTTGGGGGGGGGGGCGGGAGG + Intronic
1119680896 14:76591521-76591543 GTGTCAGTGGGGGTTGGGGGAGG + Intergenic
1119747509 14:77054660-77054682 ATTTGTGTGGGGGGGGCAGGGGG + Intergenic
1120519604 14:85511218-85511240 CTTTCAATGCGGGGGGGGGGGGG + Intergenic
1120539250 14:85734219-85734241 GTTTCAGCGGGGGGGCGGGGGGG + Intergenic
1121299443 14:92858810-92858832 GTTGCAGGGTGGGGGGAGGGGGG + Intergenic
1121449962 14:94000943-94000965 CTTGAAGTGGAGGGGGCGGGAGG + Intergenic
1121773862 14:96577281-96577303 GTGTGACTGGGTGGGGCGGGTGG + Intergenic
1122582299 14:102778046-102778068 GTTTCACGCGGGGGGACGGGCGG + Intronic
1122679792 14:103450340-103450362 GTTTTTTTGTGGGGGGCGGGAGG - Intronic
1122785837 14:104162919-104162941 GTTTCTTGGGGCGGGGCGGGGGG - Intronic
1122912308 14:104836847-104836869 GGTGCAGGGGGGGGGGGGGGGGG - Intergenic
1122960490 14:105091776-105091798 GTCTCAGTGGGCGGGGGTGGAGG + Intergenic
1123040151 14:105487109-105487131 GGTTCAGAGGGCGGGGCGCGAGG + Intergenic
1124380770 15:29162912-29162934 GTTCCAGTGGAGGTGGTGGGGGG - Intronic
1124667955 15:31609823-31609845 GTTCCAGTGGAGGTGGCAGGGGG - Intronic
1124884232 15:33669836-33669858 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1124943444 15:34240094-34240116 GTTTTACTGTGGGGGGAGGGGGG - Intronic
1126532327 15:49724916-49724938 GTTTTAGTGGGGGATGCTGGGGG - Intergenic
1126704947 15:51397873-51397895 GTTTCAGGGGGGAGGGATGGCGG - Intronic
1126738425 15:51754044-51754066 GTGTGAGTGGGGGGGACGGGGGG + Intronic
1126815795 15:52452120-52452142 TTTTCAGTGGGGGGAGGGGGTGG - Intronic
1127184672 15:56465594-56465616 GCTTCTGCGGGGGGGGGGGGGGG - Intergenic
1127396387 15:58546936-58546958 GTTGGAGTGGGGGAGGTGGGAGG - Intronic
1127589902 15:60412486-60412508 TTTTTAATGGGGGGGGTGGGTGG - Intergenic
1128035245 15:64519110-64519132 GGTGCAGGGCGGGGGGCGGGGGG + Intronic
1128336808 15:66791941-66791963 GTTTCAGTGGGGAGGGATTGAGG - Intergenic
1128635437 15:69299406-69299428 ATTAAAGTGGGGGCGGCGGGAGG - Intronic
1129097554 15:73225192-73225214 GTTCCAGTGGAGGTGGCAGGGGG + Intronic
1129521323 15:76188084-76188106 GTTCCAGTGGGGCGGGGTGGGGG - Intronic
1129615830 15:77098196-77098218 GTGTCGGGGGGGGGGGTGGGGGG + Intergenic
1130086059 15:80779258-80779280 GTTTCATCGGGGGGCGAGGGAGG + Intergenic
1130121207 15:81049188-81049210 GTTTAAGTGGGGAGGGCAGGGGG - Intronic
1132028432 15:98421534-98421556 GCTTCAGTGGGGGCAGCGTGCGG + Intergenic
1132341081 15:101078940-101078962 GGTGCAGTGTGGTGGGCGGGAGG - Intergenic
1132678623 16:1130818-1130840 GATGCAGTGGGGGGGGCCGGAGG + Intergenic
1132817044 16:1834935-1834957 TTTTTAGTGGGGGGGGGTGGGGG - Intronic
1133609046 16:7416083-7416105 GTTTCAGATTGGGGGGCTGGAGG - Intronic
1133978963 16:10619525-10619547 GTGGCAGTGGGGGGAGCAGGTGG + Intergenic
1134141902 16:11727656-11727678 GGTGGGGTGGGGGGGGCGGGTGG - Intronic
1135964533 16:27024864-27024886 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1136451531 16:30356698-30356720 GTTTTGGTGGGGGGGGAGGGGGG - Intergenic
1136464600 16:30433607-30433629 GTTTCAGAGGTGGAGGCAGGAGG + Intergenic
1137506908 16:49062014-49062036 GCTTGAGTGGGGAGGGTGGGAGG - Intergenic
1138198014 16:55068494-55068516 GTATCTGTGTGGGGGGGGGGGGG - Intergenic
1138562529 16:57810495-57810517 GTGTCAGCGGGGCGGGCGGGAGG - Intronic
1138691748 16:58775280-58775302 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1138881072 16:61015152-61015174 ATTTCAGTGGAGGTGGCAGGGGG - Intergenic
1139277556 16:65741903-65741925 GTTTCAGAGGCTGAGGCGGGTGG + Intergenic
1139535810 16:67572941-67572963 GTTTTGGGGGGGGGGGCGGGGGG - Intronic
1139575661 16:67840580-67840602 GTCTAATTGCGGGGGGCGGGAGG + Intronic
1139806170 16:69566534-69566556 GTGACGGTGGAGGGGGCGGGCGG + Intronic
1139836011 16:69839147-69839169 GTTGGATTGGGTGGGGCGGGTGG + Intronic
1140049528 16:71467953-71467975 GACTCAGTGGGGGGGGGGGGGGG + Intronic
1140315026 16:73888297-73888319 GTTTCCGTGGGGGGAAGGGGAGG - Intergenic
1140347949 16:74233299-74233321 CTTTAAGTGGGGGGGGGGGGGGG + Intergenic
1141333208 16:83131191-83131213 GTGTCTGTGGGCGGGGGGGGGGG - Intronic
1141916008 16:87097573-87097595 GTGTCAGGGGGGGCGGGGGGGGG + Intronic
1142129694 16:88427065-88427087 GATTGAGTGGAGGGGGAGGGAGG - Intergenic
1142510323 17:388977-388999 GTATCAGTGGGGAGGGAGTGAGG - Intergenic
1142623389 17:1178848-1178870 GGTGCGGTGGTGGGGGCGGGGGG + Intronic
1142674575 17:1505776-1505798 GTCTCTGTGAGGGAGGCGGGAGG - Intronic
1142770828 17:2095556-2095578 GTTTCACTTGGGGGGTTGGGTGG + Intronic
1143077574 17:4357501-4357523 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
1143544939 17:7590249-7590271 TCTTGGGTGGGGGGGGCGGGGGG - Intronic
1143590690 17:7884744-7884766 GTAGCGGTGGGGGAGGCGGGCGG + Intronic
1143653194 17:8277072-8277094 GTCTCAGGGGTGGGGGTGGGGGG + Intergenic
1143690259 17:8556597-8556619 GTTTCAGGGGCAGGGGCAGGAGG + Intronic
1144620126 17:16813363-16813385 GTTACAGAGGGCAGGGCGGGGGG - Intergenic
1144892559 17:18502336-18502358 GTTACAGAGGGCAGGGCGGGGGG + Intergenic
1145139655 17:20441951-20441973 GTTACAGAGGGCAGGGCGGGGGG - Intergenic
1145855292 17:28150643-28150665 GTTTTAGTGGGGGCGGGGGAAGG - Intronic
1146022731 17:29293228-29293250 GTCTCGGTGGGGGGGGCTGTTGG - Intronic
1146092562 17:29894698-29894720 GTTTAAGTGGTGGGAGTGGGTGG - Intronic
1146276180 17:31517199-31517221 GGGGCGGTGGGGGGGGCGGGGGG + Intronic
1146312497 17:31779968-31779990 GATTTAGTGGGGGTGGGGGGTGG - Intergenic
1146682163 17:34816210-34816232 GTTGCAGTGGGGTGGGGAGGGGG - Intergenic
1147736614 17:42642774-42642796 GTTTCAGTGGGGTGGGAGTGGGG - Intergenic
1147792357 17:43021599-43021621 GTTTTAATGGGGGGGGGGGGGGG + Intronic
1147847054 17:43411827-43411849 GTTTCAGGGGGTGGGGGGTGTGG + Intergenic
1148142258 17:45337254-45337276 GTGTGTGTTGGGGGGGCGGGGGG + Intergenic
1148938001 17:51180404-51180426 ATTTTAGTCGGGGGGGCAGGGGG - Exonic
1150144945 17:62760844-62760866 GTTGCGGTGGGGGTGGAGGGGGG + Intronic
1150254922 17:63736832-63736854 TTTTTGGTGGGGGGGGCGTGGGG - Intronic
1150314396 17:64156319-64156341 GTTTCAGAGTGGGGGTAGGGAGG - Intronic
1151104813 17:71600565-71600587 GTGTCAGTGAGGAGGACGGGTGG - Intergenic
1152024743 17:77801590-77801612 GTTTATGTGGGTGGGGCTGGGGG - Intergenic
1153030914 18:712312-712334 GCTGCAGTCGGCGGGGCGGGAGG + Intronic
1153226612 18:2905284-2905306 GCCTCTGTGGGTGGGGCGGGGGG + Intronic
1153316050 18:3723556-3723578 GTTTGTGTGGGGGGGGAGTGGGG + Intronic
1154960430 18:21302962-21302984 CTTTCAGGGGCGGAGGCGGGTGG - Intronic
1155170083 18:23260600-23260622 GCTTAAGTGGGTGGGGTGGGGGG + Intronic
1156036716 18:32772560-32772582 CTTTCAGAGGGGTTGGCGGGGGG - Intronic
1157352915 18:46906766-46906788 GTGTGTGTGGGGGGGGGGGGAGG + Intronic
1157540915 18:48505826-48505848 GTTCCAGTGGAGGTGGTGGGAGG - Intergenic
1157596925 18:48869721-48869743 CTTCCAGTGGGGAGGGCTGGGGG + Intergenic
1158805886 18:60972258-60972280 GTTTGTGTGGTGGGGGCGGTGGG - Intergenic
1160161372 18:76473894-76473916 GTTTTTGTGTGGGGGGGGGGGGG + Intronic
1160240391 18:77118577-77118599 GTGTGTGTGGGTGGGGCGGGTGG - Intronic
1161620161 19:5293317-5293339 GTTGCAGTGGGCGGGGCTGCAGG + Intronic
1161852231 19:6743599-6743621 GTGTGTGTGGCGGGGGCGGGGGG + Intronic
1161870072 19:6863186-6863208 TTTTTTGTGGGGGGGGCGGGTGG + Intergenic
1162111779 19:8403594-8403616 GATACCGTGGCGGGGGCGGGCGG - Exonic
1162186955 19:8913144-8913166 GTTGCAGGGTGGGGGGAGGGGGG + Intronic
1162319634 19:9963557-9963579 TTTTTGGGGGGGGGGGCGGGTGG + Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1163312222 19:16521487-16521509 AGGTCAGTGGGGTGGGCGGGAGG - Intronic
1163595136 19:18216928-18216950 GGTAGAGTGGGTGGGGCGGGTGG - Intronic
1163642084 19:18467610-18467632 GGTTGTGTGGTGGGGGCGGGTGG - Intronic
1163820671 19:19494770-19494792 GTTTGAGAGGGAGGGGCAGGAGG - Intronic
1163944137 19:20520309-20520331 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1164153291 19:22572695-22572717 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1164202165 19:23027899-23027921 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1164777541 19:30864637-30864659 GTTTCACAAGTGGGGGCGGGAGG - Intergenic
1165130174 19:33627093-33627115 TTTTTTGGGGGGGGGGCGGGTGG + Intronic
1165300413 19:34964616-34964638 CTTTTTGCGGGGGGGGCGGGGGG + Intergenic
1165583677 19:36893123-36893145 GTTTAAATGTCGGGGGCGGGTGG + Intronic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167377476 19:49119648-49119670 GGTGGAGTGGGGGGGCCGGGCGG - Exonic
1168211803 19:54896087-54896109 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1168218484 19:54943596-54943618 GTCTGGGTTGGGGGGGCGGGGGG + Intronic
1168228698 19:55014986-55015008 GGGTCAGCGGGAGGGGCGGGAGG + Exonic
1168246989 19:55117444-55117466 GCGGCAGTGGGGGGCGCGGGCGG - Exonic
1168248575 19:55127474-55127496 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1168314196 19:55476859-55476881 GTTGCAGGGGGTGGGGCGGGGGG + Intronic
1202695088 1_KI270712v1_random:117828-117850 GAGTCAGTGGGAGGGGCTGGCGG + Intergenic
925130876 2:1493198-1493220 GTGTGAGTGGGTGGGGGGGGGGG + Intronic
925339854 2:3128583-3128605 GTTTCAGTTGGGGTGCCAGGAGG + Intergenic
926086823 2:10025617-10025639 TTTTCTGGGGGGGGGGGGGGCGG - Intergenic
927134465 2:20086673-20086695 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
928198024 2:29228918-29228940 GTTTCGGAGGGGGTGGAGGGGGG - Exonic
928462302 2:31485983-31486005 CTCTCAGTGGGAGGGGCAGGAGG - Intergenic
928887546 2:36167368-36167390 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
929080363 2:38116387-38116409 GTTGCACTGGGTGGGGGGGGCGG + Intergenic
929103460 2:38340164-38340186 GTTTTGGTGGGGGGGGGGGGGGG + Intronic
929754627 2:44753896-44753918 GTCTCACTGGAGGGGGTGGGAGG - Intronic
930486457 2:52017523-52017545 GTTTCAGTGGAGGTGGCAGGGGG + Intergenic
931038460 2:58269082-58269104 GAATCAGTGGGGGGGTAGGGCGG - Intergenic
931748047 2:65307944-65307966 GTGTGAATGGGGGGGGCGGGGGG - Intergenic
931882276 2:66579652-66579674 GCTGCGGGGGGGGGGGCGGGGGG + Intergenic
931893923 2:66707450-66707472 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
931951076 2:67362098-67362120 GTTTTGGTGTGGGGGGAGGGGGG + Intergenic
932105304 2:68936464-68936486 CTTTCAGTGGGGTGGGGCGGGGG - Intergenic
932161568 2:69465108-69465130 GTTTCTGTGGGTGGGGCGGGGGG + Intronic
932629152 2:73323415-73323437 GTTTAAGTGGGGAGGTTGGGAGG - Intergenic
932698746 2:73978750-73978772 GATTCCGGGGGGGGGGAGGGGGG - Intergenic
932969853 2:76527645-76527667 GCTTCAATGCGGGGGGAGGGGGG - Intergenic
934276258 2:91574877-91574899 GAGTCAGTGGGAGGGGCTGGCGG + Intergenic
934523337 2:95033413-95033435 GTTTCAGTGGCGGGCCAGGGAGG + Intronic
935457508 2:103287473-103287495 CTTTTTGTGGGGGGGGGGGGTGG - Intergenic
935581858 2:104762695-104762717 GTTTCTGTGTTGGGGGCAGGAGG - Intergenic
935644537 2:105323253-105323275 ACTTCAGTAGAGGGGGCGGGGGG + Intronic
936477764 2:112854874-112854896 GTTTCACTTGAGGGGGTGGGAGG + Intergenic
936899795 2:117469926-117469948 GTGTGTGTTGGGGGGGCGGGGGG - Intergenic
937752087 2:125488357-125488379 GTGTATGTGGCGGGGGCGGGTGG - Intergenic
938296494 2:130182447-130182469 GTTCAAGTGAGCGGGGCGGGTGG + Exonic
938297582 2:130188048-130188070 TTTTGAGTGGTGGGGGAGGGGGG - Intronic
938460257 2:131492190-131492212 GTTCAAGTGAGCGGGGCGGGTGG - Exonic
938566699 2:132525168-132525190 GTGACAGTGGGGAGGGCTGGGGG - Intronic
938583811 2:132670289-132670311 GTTGGGGTGGGGGTGGCGGGCGG + Intronic
939393450 2:141599060-141599082 GTTAAAGCGGGGGGGGGGGGGGG - Intronic
939626126 2:144479679-144479701 TTTTTGGGGGGGGGGGCGGGGGG + Intronic
939939320 2:148330037-148330059 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
939984458 2:148815933-148815955 GGTGCAGTGGGGGGGGTGGGGGG - Intergenic
940183281 2:150957502-150957524 GTTTCAGTGGGAGGGTAGGTGGG - Intergenic
940214936 2:151295204-151295226 GTGTGTGTGGGGGGGGGGGGCGG - Intergenic
940508506 2:154584723-154584745 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
941455821 2:165711377-165711399 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
941866902 2:170344461-170344483 GTCTCGGTTGGGGGGGTGGGGGG + Intronic
942459313 2:176158811-176158833 GTTGGAGTGGGGGGGGTGGGAGG - Intronic
943061869 2:183048228-183048250 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
943456929 2:188120120-188120142 GTGTCAGTGGAGGGGCCTGGTGG - Intergenic
944636679 2:201681822-201681844 GTTTCAGTGTAGGGTGGGGGGGG - Intronic
945166245 2:206949872-206949894 GCTTCAATGGTGGTGGCGGGTGG - Intronic
945369063 2:208994205-208994227 CTTTCTTTTGGGGGGGCGGGGGG + Intergenic
946036510 2:216746550-216746572 GTTCCAGTGGAGGTGGCAGGAGG - Intergenic
946360959 2:219219038-219219060 GTCTCCGAGGGGGGAGCGGGGGG + Intronic
946418871 2:219553834-219553856 CTGTCAGTGGTGGGGGTGGGGGG + Intronic
947101623 2:226627332-226627354 CTTTCAGTGGTGGAGGAGGGAGG + Intergenic
947109051 2:226699014-226699036 TTTTAAGTGGGTGGGGAGGGTGG + Intergenic
947333451 2:229054712-229054734 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
947411718 2:229848320-229848342 GTGTGTGTGGGGGGGGCGGGGGG - Intronic
947685807 2:232083281-232083303 GTATATGTGGGGGGGGGGGGGGG - Intronic
947791148 2:232870166-232870188 GTGTTGGTGGGGGGAGCGGGGGG + Intronic
947842474 2:233216904-233216926 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
948355746 2:237375537-237375559 TTTGCAGTGGAGGGGTCGGGGGG + Intronic
1168878004 20:1184717-1184739 GTGTCAGTGCGCGCGGCGGGTGG - Intronic
1169385433 20:5145242-5145264 GATTTGGTGGCGGGGGCGGGGGG - Intronic
1169664317 20:8018256-8018278 GTTTGGGGGGTGGGGGCGGGAGG + Intronic
1169982170 20:11396889-11396911 TTTTTTGTGGGGGGGGAGGGGGG - Intergenic
1170487737 20:16836606-16836628 GTTTCAGAGTAGGGGGCTGGGGG + Intergenic
1170664026 20:18370182-18370204 GTTGTGGGGGGGGGGGCGGGGGG + Intergenic
1170853022 20:20021027-20021049 GGTTCGGTGGGCGGGGGGGGGGG + Intronic
1171180174 20:23085833-23085855 GCTTCAGCTGGGTGGGCGGGGGG - Exonic
1171421400 20:25020282-25020304 CTTTCACTGGCGGGGGTGGGGGG - Intronic
1172134205 20:32676106-32676128 GTGTTAGTGGGGTGGGCGTGGGG - Intergenic
1172774540 20:37399309-37399331 GTCTCATTTTGGGGGGCGGGTGG + Intronic
1173400543 20:42722196-42722218 GATTCAGTCGGTGGGGTGGGGGG + Intronic
1173731895 20:45335075-45335097 GCTTCAGTGGGGGTGGGGGCGGG - Intronic
1173737582 20:45372915-45372937 GTGTGAGTGGGCGGGGTGGGAGG + Exonic
1173841776 20:46162116-46162138 CTTTCAGTGGGGGAGGCTGTGGG - Intergenic
1173895437 20:46547185-46547207 GTTTGAGTGGAGGGGGAGAGAGG + Intronic
1174021545 20:47534100-47534122 GTTTCAGTGGGGGGGGCGGGGGG + Intronic
1174626474 20:51919010-51919032 GTTTCAGTGGGCTGGCAGGGCGG + Intergenic
1174764057 20:53235121-53235143 GTTTTGTTGGGCGGGGCGGGGGG + Intronic
1175158403 20:56989956-56989978 TTGTGTGTGGGGGGGGCGGGGGG + Intergenic
1175256919 20:57653112-57653134 GGGTCAGTGGGGTGGGCAGGAGG + Intronic
1176070616 20:63224467-63224489 GTATTAATGGGGAGGGCGGGAGG - Intergenic
1178699025 21:34818146-34818168 GTTTCAGTGCTGGGGTGGGGTGG + Intronic
1178801730 21:35801669-35801691 GTTCCAGTGGAGGTGGCAGGGGG - Intronic
1178824495 21:36004704-36004726 GTGCCGGTGGTGGGGGCGGGAGG + Intergenic
1178837861 21:36113662-36113684 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1178959088 21:37047615-37047637 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1179568088 21:42261541-42261563 GTTTCAGTGGAGAGAGGGGGTGG - Intronic
1179890866 21:44334519-44334541 GGTTGAGCGGGGGGGGGGGGGGG - Intronic
1180053277 21:45343460-45343482 GTTTCATTTGGGGGTGCGGAGGG + Intergenic
1180154364 21:45970929-45970951 GCTTCAGTGGGAGGGGAGGAGGG + Intergenic
1180232630 21:46436474-46436496 GTGCCAGCGGGGGGGGGGGGGGG - Intronic
1180250751 21:46585817-46585839 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1180843529 22:18970106-18970128 GCTTCTGTGCAGGGGGCGGGGGG + Intergenic
1180847899 22:18994373-18994395 GTGTCAGTGGGACGGGAGGGTGG + Intergenic
1181297380 22:21851140-21851162 GTTTCCGGGGAGGGGGTGGGTGG + Intronic
1182080713 22:27526896-27526918 GTGGCAGTGGGTGGGGAGGGGGG - Intergenic
1182689030 22:32143514-32143536 GTTTCACTGCCGGGGGCTGGTGG - Intergenic
1183267498 22:36838190-36838212 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1183917427 22:41133157-41133179 GTTTCCGGGGTGGGGGTGGGGGG - Intronic
1184101006 22:42341764-42341786 GGATCAGCGGGGTGGGCGGGGGG + Intronic
1184106346 22:42369346-42369368 GTTTCCGCGGGGAGGGCGGCCGG - Intergenic
1184151704 22:42643445-42643467 GTTGCAGGGTGGGGGGTGGGGGG - Intronic
1184321098 22:43742767-43742789 GGTGCAGTGGGGGTGCCGGGAGG - Intronic
1184988047 22:48148842-48148864 GTTGCAGAGTGGGGGGCAGGGGG - Intergenic
1185344805 22:50306597-50306619 CATTAAGTGGGGAGGGCGGGGGG + Intronic
949736015 3:7172544-7172566 ATATATGTGGGGGGGGCGGGGGG - Intronic
950903586 3:16517633-16517655 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
951780294 3:26355394-26355416 ATTTCAGTGGGGTGGGGGTGGGG - Intergenic
951894930 3:27601588-27601610 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
952584556 3:34875294-34875316 CTTTGAGTGGGGGAGGCGGGCGG + Intergenic
953444661 3:42952822-42952844 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
953752516 3:45619822-45619844 TTTTTGGGGGGGGGGGCGGGGGG - Intronic
953834118 3:46328372-46328394 GTTTCAGTGGGAGGGTAGGCGGG + Intergenic
954433920 3:50485959-50485981 GTGTCAGTGGCCGGGGTGGGTGG - Intronic
954754837 3:52833547-52833569 GTGTCAGTGGTGGGGGGAGGTGG - Intronic
955059844 3:55485206-55485228 GGTTCCTTGGGGCGGGCGGGCGG - Intronic
955186059 3:56716602-56716624 GGTTGGGCGGGGGGGGCGGGGGG - Intergenic
955272086 3:57510726-57510748 GATTCAGTGGGGACGGGGGGAGG + Intronic
956035336 3:65084669-65084691 GTAGCAGTGGTGGGGGTGGGGGG - Intergenic
956233203 3:67040038-67040060 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
956312525 3:67897030-67897052 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
956593205 3:70938489-70938511 TTTGCAGTGGGGGTGGGGGGTGG - Intergenic
956799591 3:72744916-72744938 GATACATTGGGGGGGGGGGGTGG + Intergenic
956979398 3:74617697-74617719 GTTGCAGTGGGGGGGTTGGTGGG + Intergenic
957065493 3:75518727-75518749 GTTTTTTTGGGGGGGGCGGGGGG - Intergenic
957451764 3:80389319-80389341 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
957952523 3:87144699-87144721 GTCTCAGGGTGGGGGGCAGGGGG - Intergenic
958122514 3:89309871-89309893 GTTTGTGTGTGGGGGGTGGGGGG - Intronic
958875665 3:99613790-99613812 GTGTGTGGGGGGGGGGCGGGTGG - Intergenic
959504188 3:107139936-107139958 GTGGCAGTGGGGGTGGGGGGTGG - Intergenic
960173108 3:114486130-114486152 GTGTGTGTGGGGGGGGGGGGCGG + Intronic
960601396 3:119462628-119462650 CTTCAAGGGGGGGGGGCGGGGGG + Intronic
961290891 3:125845873-125845895 CTTTCAGTGGGGGGTGGGGTGGG - Intergenic
961359525 3:126358065-126358087 GTTTCAGGTGGGGGGGGGGGGGG - Intergenic
961427306 3:126858291-126858313 GTGGCAGGGGCGGGGGCGGGGGG + Intronic
961529415 3:127531537-127531559 TTATCAGTGGGGGGGGGGGGGGG - Intergenic
961537753 3:127580279-127580301 GCTGCAGTGGGTGGGGAGGGTGG - Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962229553 3:133650355-133650377 GTGTGTGTGTGGGGGGCGGGGGG + Intronic
962305945 3:134286232-134286254 TTGGCAGTGGGGGGGGTGGGGGG + Intergenic
962517715 3:136169224-136169246 GTTTTGGCGGGGGGGGGGGGGGG + Intronic
963887770 3:150600961-150600983 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
964532253 3:157681462-157681484 CCTTTAGTGGGGGAGGCGGGTGG - Intergenic
965032624 3:163391997-163392019 GTTTCAGTGGTGGGGGTGCTGGG - Intergenic
965321841 3:167261218-167261240 GTTCCAGTGGAGGTGGCGGAGGG + Intronic
965335473 3:167427430-167427452 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
965712456 3:171569362-171569384 GTTTTATGGGGGGGGGGGGGGGG - Intergenic
966038165 3:175446238-175446260 CTTTTTTTGGGGGGGGCGGGGGG + Intronic
966188373 3:177248303-177248325 TTTTTTGTGGGGGGGGTGGGGGG - Intergenic
966397300 3:179516771-179516793 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
966783213 3:183602718-183602740 GTGTCGGTGGGGAGTGCGGGGGG + Intergenic
967089381 3:186122226-186122248 GTGTGAGTGGGGGGGTGGGGAGG + Intronic
967119583 3:186371095-186371117 TGTTCAGTGGGAGGGGAGGGCGG - Intergenic
967724530 3:192849311-192849333 TTTTTTGGGGGGGGGGCGGGGGG + Intronic
968242764 3:197106419-197106441 TTTTCATTGAGGGGGGTGGGGGG - Intronic
968710556 4:2113232-2113254 GTTGCAGGGTGGGGGGAGGGGGG + Intronic
969449893 4:7266962-7266984 GAATCAGTGGGGGGTGGGGGAGG + Intronic
969563976 4:7966865-7966887 GTGTCCATGGGGTGGGCGGGAGG - Exonic
969776719 4:9362677-9362699 GTTTGTGTGTGGGGGGGGGGGGG - Intronic
969880576 4:10170118-10170140 GTTACTGGGGGGGGGGGGGGTGG + Intergenic
970897145 4:21117295-21117317 GTTGCCGGGGGGGGGGGGGGGGG + Intronic
971182347 4:24340859-24340881 TTGTCAGTGGGAGTGGCGGGTGG - Intergenic
971598149 4:28558241-28558263 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
972960752 4:44448848-44448870 CTCTCCGTGGGGAGGGCGGGAGG + Intergenic
973179527 4:47251334-47251356 GTTCCAGTGGAGGTGGCAGGGGG + Intronic
973237103 4:47917188-47917210 GTTGCAGGGTGGGGGGCTGGTGG - Intronic
974066372 4:57081382-57081404 GTGTGAGTGGGAGGGGCTGGTGG - Intronic
974992630 4:69113668-69113690 GATTCAGAGGGGAGGGTGGGAGG - Intronic
975241979 4:72070553-72070575 GTGTGTGTGGGGGGGGGGGGTGG + Intronic
975541073 4:75512897-75512919 ATTTAAGGGGGGGGGGGGGGCGG + Intronic
976719251 4:88154100-88154122 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
976925018 4:90485516-90485538 GTTAAATTGGGGGGGGGGGGTGG - Intronic
977782139 4:100993126-100993148 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
980055720 4:128077498-128077520 TTTGCAGGGGCGGGGGCGGGAGG - Intronic
980325018 4:131332604-131332626 GTGTCTGTGGTGGGGACGGGGGG + Intergenic
981604290 4:146526138-146526160 GTTAGAGTGGGGGGTGGGGGCGG - Intergenic
982155073 4:152511286-152511308 GATTCGGTGGGGGGGGCGGGGGG - Intronic
983056306 4:163102127-163102149 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
983502071 4:168511120-168511142 GTTTGAGTAAGGTGGGCGGGGGG + Intronic
983646383 4:169996009-169996031 ATTTCAGGGTGGGGGGTGGGGGG - Intronic
984291112 4:177795718-177795740 GTTGTGGTGGTGGGGGCGGGAGG + Intronic
984313539 4:178096340-178096362 GTTCCAGTGGGGGTGGGGGTTGG - Intergenic
984412077 4:179407817-179407839 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
984544850 4:181089225-181089247 GTTGCGGGGGGGGGGGGGGGGGG + Intergenic
984605870 4:181785701-181785723 TTTTCAGTGGCGGGGGTTGGGGG - Intergenic
984769757 4:183427190-183427212 TTTTTGGGGGGGGGGGCGGGGGG + Intergenic
985551538 5:535718-535740 GTCTCTGTGGGGTGGGCGGGGGG - Intergenic
985711031 5:1430127-1430149 GTTTCAGAAGGTGGGGCAGGCGG - Intronic
985986540 5:3521206-3521228 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
986715541 5:10521180-10521202 TCTGCTGTGGGGGGGGCGGGGGG - Intronic
986870282 5:12037068-12037090 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
987338868 5:16921880-16921902 GTTGCAGTGGTGGGTGAGGGCGG - Intronic
988041312 5:25892007-25892029 GTTTTATTGGCGGGGGCAGGGGG + Intergenic
988527429 5:31999249-31999271 TTTTTTTTGGGGGGGGCGGGTGG + Intronic
988748667 5:34172433-34172455 GGTTGGGCGGGGGGGGCGGGGGG + Intergenic
988937192 5:36096263-36096285 GTTCCAGTGGTGGGGGTGGGTGG - Intergenic
989687864 5:44110471-44110493 GTGACAGTGGGGGTGGGGGGTGG - Intergenic
990762451 5:59144883-59144905 GGTTTAATGGGGGGGGGGGGGGG + Intronic
991038628 5:62153563-62153585 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
991316194 5:65309455-65309477 GTGGCAGTGGGGGGGTGGGGAGG + Intronic
991321444 5:65377684-65377706 GTTTCAGTGGGTGGGAGGGATGG + Intronic
991539487 5:67711058-67711080 CTTCCAGTTTGGGGGGCGGGGGG - Intergenic
992026686 5:72676987-72677009 CTTTGAGAGGGGGAGGCGGGTGG - Intergenic
992950410 5:81852293-81852315 GTGCCTGTGGGGTGGGCGGGGGG + Intergenic
993978108 5:94507449-94507471 GTTTTTTTGGGGGGGGCGGGGGG - Intronic
993989709 5:94641183-94641205 GTTTTTGTGGGGGGGTGGGGCGG - Intronic
994125786 5:96168144-96168166 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
994129539 5:96209645-96209667 GATTGGGTGGGGTGGGCGGGGGG - Intergenic
994222132 5:97208419-97208441 GTTTCGGTGGAGGTGGCAGGGGG + Intergenic
994570939 5:101513137-101513159 CTTTCCTTGGGGGGGGGGGGGGG + Intergenic
994682064 5:102900249-102900271 GTGTGTGGGGGGGGGGCGGGGGG + Intronic
994735446 5:103548186-103548208 GGTTCTGGGGGGGGGGAGGGAGG - Intergenic
994875358 5:105414249-105414271 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
995082384 5:108068453-108068475 TTTTTTGGGGGGGGGGCGGGGGG + Intronic
995462504 5:112419089-112419111 GCTTGAGTGGAGGGGGCGGCTGG - Exonic
995545052 5:113221792-113221814 AATTTAGTGGTGGGGGCGGGGGG - Intronic
996137928 5:119868417-119868439 GTTTGTGTGGGGGGGTGGGGCGG - Intergenic
996869078 5:128165919-128165941 TTTTAACTGGGGGGGGGGGGGGG - Intronic
996897607 5:128503937-128503959 GTTTGAGTGTGGGGGGCCTGGGG - Intronic
997114989 5:131117006-131117028 GTTGCAGGGTGGGGGGCTGGGGG - Intergenic
997678488 5:135732779-135732801 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
997692608 5:135836968-135836990 GTGTGTGTGGGGGGGGGGGGTGG - Intronic
997740871 5:136252620-136252642 GTTGGAGTGGGGGTGGAGGGTGG + Intronic
997820499 5:137061737-137061759 GATAGAGTGGAGGGGGCGGGTGG + Intronic
998156110 5:139788171-139788193 GGTTCGGGGGGGGGCGCGGGGGG - Intergenic
999058266 5:148605499-148605521 GTTTCAGAGGCCGAGGCGGGTGG - Intronic
999279455 5:150355476-150355498 GTGTATGTGGGGGGGGGGGGCGG - Intergenic
999318825 5:150601020-150601042 GTGTCAGGGGGGCGGGCGGGAGG - Intergenic
999682667 5:154074575-154074597 AATTGTGTGGGGGGGGCGGGGGG + Intronic
1000779697 5:165465283-165465305 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1000896188 5:166858440-166858462 TTTTTTTTGGGGGGGGCGGGGGG - Intergenic
1000937608 5:167321797-167321819 TTTTTGGGGGGGGGGGCGGGGGG + Intronic
1001051194 5:168415791-168415813 GTGTGTGTGGGGGGGGGGGGGGG + Intronic
1001124449 5:169006932-169006954 GTTGCAGTTGGGGGGTGGGGTGG - Intronic
1001180939 5:169520131-169520153 GTCTAAGTGGGGGGGGGGTGGGG - Intergenic
1001450841 5:171823173-171823195 GTTTTAGTGGGAGGGGCCAGGGG + Intergenic
1002087949 5:176787524-176787546 GTCTCCATGGTGGGGGCGGGGGG + Intergenic
1002093012 5:176815806-176815828 GTGTCAATGGCGGGGGAGGGGGG - Intronic
1002792543 6:446697-446719 TCTTCAGTGGGGGGTGCTGGGGG + Intergenic
1002813904 6:660399-660421 GTTCCAGTGGAGGTGGCGGAGGG - Intronic
1002987582 6:2205769-2205791 GTGTGTGTGGGGGGGGAGGGGGG + Intronic
1003226516 6:4210938-4210960 TCTTCAGTGGGTGAGGCGGGGGG - Intergenic
1003552876 6:7114460-7114482 GTTTCTGGTGGGGGGGGGGGCGG + Intronic
1003560415 6:7175355-7175377 GTTTCAGTGGGGTGGGATGGGGG + Intronic
1004029625 6:11853658-11853680 GTTCCAGGGTGGGGGGTGGGAGG - Intergenic
1004402777 6:15304312-15304334 GTTACAGTGGGTGGGCGGGGGGG - Intronic
1004716692 6:18223341-18223363 CTTTGATTGGGGGGGGCGGGGGG - Exonic
1004841030 6:19585465-19585487 TTTTGAGTGGGTGGGGTGGGGGG + Intergenic
1005227134 6:23655979-23656001 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
1005463298 6:26089101-26089123 GTGTGTGTGGGGGGGGGGGGCGG + Intronic
1005610716 6:27521735-27521757 GTTTCAGAGGGTGAGGTGGGTGG + Intergenic
1006263319 6:32894845-32894867 CTTTCAGTGCAGGCGGCGGGAGG - Intergenic
1006404380 6:33835724-33835746 TTTGCGGGGGGGGGGGCGGGGGG + Intergenic
1007391782 6:41553546-41553568 CTTTCAGAGGTGGGGGCAGGAGG + Intronic
1007503375 6:42315707-42315729 GTGGCAGTGGGTGGGGGGGGGGG - Intronic
1007669503 6:43539666-43539688 GGTGCAGTGGGGGGGCCTGGAGG - Intronic
1007821312 6:44562355-44562377 GTTTCAGTGGGGGTGTTGGCTGG - Intergenic
1008180357 6:48320542-48320564 GTTTGGGTGGGGGGGGCGCTGGG + Intergenic
1008761631 6:54859061-54859083 GTCTCAGTGCTGGGGGCTGGGGG - Intronic
1008838462 6:55867508-55867530 ATCTCAGTGGGTGGGGCAGGCGG + Intronic
1010679379 6:78781544-78781566 GTTTCAGTGGAGGTGGCTGGGGG - Intergenic
1011112235 6:83851500-83851522 ATGTCAGTGGGTGGGGTGGGAGG - Intergenic
1011893253 6:92193797-92193819 GTTCCAGTGGAGGTGGTGGGGGG + Intergenic
1015495854 6:133882733-133882755 GGTTCAGTGGGGGCGGTGGGGGG - Intergenic
1015994170 6:138980669-138980691 TTTTTTGTGGGTGGGGCGGGGGG + Intronic
1016311188 6:142735270-142735292 TTTTGGGTCGGGGGGGCGGGGGG + Intergenic
1016751184 6:147632049-147632071 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1017281361 6:152629512-152629534 GTTTCATTGCCGGGGGGGGGGGG + Intronic
1017384936 6:153872433-153872455 ATTTTTGGGGGGGGGGCGGGGGG - Intergenic
1017675321 6:156807142-156807164 GCTTCACTGGGTGGGGCGTGGGG - Intronic
1017705979 6:157123232-157123254 GTGTGTGGGGGGGGGGCGGGGGG - Intronic
1018009459 6:159656041-159656063 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1018323414 6:162637267-162637289 TTTTTGGGGGGGGGGGCGGGTGG - Intronic
1018463545 6:164021800-164021822 GTTTGTGTGGGGGGAGTGGGGGG - Intergenic
1019036752 6:169067313-169067335 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1019102448 6:169642299-169642321 GTTTCTGTGGGCGGGGGGGAAGG - Intronic
1019379308 7:712716-712738 GTCTGAGTGGAGGGGGCGGGGGG - Intronic
1019477037 7:1249200-1249222 GTTCGGGTGGGCGGGGCGGGAGG + Intergenic
1019609774 7:1930582-1930604 GTGGCAGTGGGGTGGGCGAGGGG - Intronic
1019708926 7:2509622-2509644 GTCTCTGTTGGTGGGGCGGGCGG - Intergenic
1019719552 7:2559758-2559780 ATTCCAGTGGGGGGGGGGGGGGG + Intronic
1020083054 7:5296725-5296747 GTGGCAGTGGGCGGGGCCGGCGG + Intronic
1020642729 7:10776720-10776742 GTGTGTGTGGGGGGGGGGGGGGG + Intergenic
1021134704 7:16951209-16951231 TTTTTTTTGGGGGGGGCGGGTGG - Intergenic
1021862820 7:24923727-24923749 GCTGCAGTGGGGCAGGCGGGCGG + Intronic
1022048610 7:26643636-26643658 GTCTCAGTGGCGGCGGGGGGGGG + Intronic
1022403633 7:30065418-30065440 GTGTCTGTGGGAGGGGAGGGTGG - Intronic
1023177036 7:37445566-37445588 GTGTGAGTGGGTGGGGCGGGTGG - Intronic
1024277015 7:47685904-47685926 GTTTCAGGATGGGGGGAGGGGGG + Intergenic
1024378351 7:48664866-48664888 TTTTTTGTGGGGGTGGCGGGAGG - Intergenic
1024917179 7:54514952-54514974 GTTCCAGTGGAGGTGGCAGGGGG + Intergenic
1025020556 7:55476425-55476447 GTGTCGGGGGGGTGGGCGGGGGG + Intronic
1025813072 7:64887874-64887896 ATTTCAGAGGGGTGGTCGGGTGG + Intronic
1025928717 7:65979062-65979084 GCTTCGGTGGGGGGGGCGCCGGG - Intronic
1027122164 7:75529636-75529658 TTTTTAGTGGGGGGGTGGGGTGG + Intergenic
1027137857 7:75637979-75638001 GTGTGTGTGGGGGGGGGGGGGGG - Intronic
1027737755 7:81955898-81955920 ATTTTGGTGGGGGGGGGGGGGGG + Intronic
1027741731 7:82016604-82016626 TTTTGGGGGGGGGGGGCGGGCGG - Intronic
1028086843 7:86645968-86645990 GTTTCTTTGTGGTGGGCGGGGGG + Intronic
1028565666 7:92228008-92228030 GTCTCAGTGGGGGTTGCGGCGGG + Intronic
1029419273 7:100464072-100464094 GGTACGGTGGGGGTGGCGGGTGG + Exonic
1029433260 7:100546167-100546189 TTTTTGGTGGGGGTGGCGGGCGG - Intronic
1030120091 7:106101453-106101475 TTTTTTGTGGGGGGGGGGGGGGG - Intronic
1030163260 7:106529489-106529511 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1030403052 7:109076983-109077005 GTTTTTTTTGGGGGGGCGGGGGG - Intergenic
1030416680 7:109252759-109252781 ACTTCAGTGGGGAGGGTGGGAGG + Intergenic
1030969334 7:116034941-116034963 GTTTCAGTGGGGGAAGATGGGGG - Intronic
1031028805 7:116712689-116712711 GTGTGTGTGGGGGGGACGGGAGG - Intronic
1031135105 7:117875497-117875519 TTTGCGGTGGGGGGGGGGGGTGG - Intergenic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1032011625 7:128351374-128351396 GGTTGATTGGGGAGGGCGGGCGG + Exonic
1032441400 7:131945469-131945491 GTTTCTCTGGAGGGTGCGGGCGG + Intergenic
1032789501 7:135232108-135232130 GTGGCAGTGGTTGGGGCGGGAGG + Intronic
1033098830 7:138453617-138453639 GTGGCAGTGGGGGGTGGGGGTGG - Intergenic
1033228594 7:139579823-139579845 GATTCAGTGGATGGGGTGGGAGG - Intronic
1033346795 7:140531857-140531879 GTGTGTGTGGTGGGGGCGGGTGG + Intronic
1033738123 7:144244945-144244967 GTCTCAATGGGGGGGGTGGGGGG - Intergenic
1033744930 7:144306008-144306030 GTCTCAATGGGGGGGGTGGGGGG + Intergenic
1034140102 7:148807614-148807636 GTTTCAGAGGAGGGGGGAGGAGG + Exonic
1034352636 7:150427411-150427433 GTGTGTGTGGGGGGGGCGTGGGG + Intergenic
1034466448 7:151232684-151232706 GTTTCAGGGCCGGGGGCCGGCGG - Exonic
1034702125 7:153105554-153105576 GTGGCAGTGGGCGGGGCCGGGGG - Intergenic
1034705709 7:153141379-153141401 TTTTTTGTGGGGGGGGGGGGGGG + Intergenic
1035565551 8:638405-638427 GTTACAGTGCGGTGGGCAGGTGG + Intronic
1035741336 8:1930489-1930511 TTTTCAGCGGGGGGGCGGGGAGG - Intronic
1035850357 8:2913957-2913979 TTTTTTTTGGGGGGGGCGGGTGG + Intergenic
1036184138 8:6609813-6609835 GTGTGTGGGGGGGGGGCGGGGGG - Intronic
1036259822 8:7230629-7230651 TTTTCAGTGGTGGGGGTGGTGGG - Intergenic
1036306793 8:7608892-7608914 CTCTCAGTGGTGGGGGGGGGTGG + Intergenic
1036311865 8:7689199-7689221 TTTTCAGTGGTGGGGGTGGTGGG - Intergenic
1036357643 8:8056880-8056902 CTCTCAGTGGTGGGGGGGGGTGG + Intergenic
1037031759 8:14115788-14115810 GTTTCTTTGGGGGGTGGGGGTGG + Intronic
1037410028 8:18586534-18586556 ATTCCAGTGGGTGGGGCAGGGGG + Intronic
1037520990 8:19680565-19680587 TTTTTTGTGGGGGGGGGGGGGGG - Intronic
1037670724 8:21013136-21013158 GTGTGTGTGGGGGGGGGGGGGGG - Intergenic
1037733646 8:21549769-21549791 ATTTCAGTGGGGTGGGAGGTGGG - Intergenic
1037762237 8:21749220-21749242 TTTGCAGGGGGAGGGGCGGGTGG - Intronic
1037796272 8:21997832-21997854 GATTCAGTGTGGTGGGGGGGAGG + Intronic
1037947574 8:22999152-22999174 GGGGCAGTCGGGGGGGCGGGGGG - Intronic
1038426874 8:27469493-27469515 GTTTCAGAGTGGGTGGCGGGCGG - Intronic
1038989793 8:32855675-32855697 CTTTCAGTGGGGGTGGGGGCAGG - Intergenic
1039075798 8:33689595-33689617 GCTTCAGTGGGCGGGGGAGGGGG - Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1039457468 8:37717046-37717068 ATTTGTGTGTGGGGGGCGGGGGG + Intergenic
1039473077 8:37826056-37826078 GCATCAGTGGGGCAGGCGGGTGG + Intronic
1040067885 8:43163107-43163129 GTTGCAGTGAGGTGGGAGGGAGG + Intronic
1040471090 8:47736772-47736794 GTGTGTGTGGGGGGGGCGGGGGG - Intergenic
1041287762 8:56278314-56278336 TTTTTTGTGGGGGGGGAGGGGGG - Intergenic
1041651496 8:60307540-60307562 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1041917177 8:63149385-63149407 GTTTCAGTGGGGGCAGTAGGTGG + Intergenic
1042088653 8:65134209-65134231 GTTTCAGTGGAGGTGGCAGAGGG - Intergenic
1042119337 8:65467363-65467385 GTTGCAGGGTGGGGGGAGGGGGG + Intergenic
1042348289 8:67750049-67750071 GTTTCAGCGGGGTGGTAGGGAGG - Intergenic
1042388411 8:68204032-68204054 ATTTTGGTGGGTGGGGCGGGGGG - Intronic
1042813896 8:72856920-72856942 GTTTCTGTGGTGGGGGAAGGGGG - Intronic
1042914787 8:73864747-73864769 TTTTGGGGGGGGGGGGCGGGGGG + Intronic
1043040838 8:75259932-75259954 GTTCCAGTGGAGGTGGCAGGGGG - Intergenic
1043512467 8:80963083-80963105 GTTCCAGAGGGGTTGGCGGGGGG + Intergenic
1043599206 8:81918116-81918138 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1044861691 8:96530013-96530035 GATTTAGTGGCAGGGGCGGGGGG + Intronic
1045302131 8:100920783-100920805 GTTTCAGTGGGATGGGGGGGGGG + Intronic
1045601708 8:103724052-103724074 ATTTCTGTGGGGGGGCGGGGCGG - Intronic
1046075186 8:109304861-109304883 GTTTCAGTGGGGGAGTTGGTGGG - Intronic
1046082241 8:109384609-109384631 GTATAAGTGGTGGGGGTGGGAGG - Intronic
1046870959 8:119205530-119205552 GTGGCAGTGGGGGAGGCGGGGGG + Intronic
1048986424 8:139737464-139737486 TTTTCCGTGGGGGGGGGGGGAGG - Intronic
1049167219 8:141133864-141133886 GGTGCAGTGGGGGTGGCAGGAGG + Intronic
1050160244 9:2711375-2711397 GCTTTGGTGGGGGGGGGGGGTGG + Intergenic
1050429125 9:5543861-5543883 ATTTCAATGGGGTGGGGGGGAGG + Intronic
1050620016 9:7442539-7442561 GTGTCAGGGCGGGGGGGGGGGGG - Intergenic
1052307964 9:27032323-27032345 GTTTTAGTGGGGTTTGCGGGAGG + Intronic
1052902856 9:33809427-33809449 GTTTCAGTGGTGAGGGCAGAGGG + Intergenic
1053059665 9:35021061-35021083 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1053372733 9:37576268-37576290 GCTCCAGCGGGGGCGGCGGGTGG - Intronic
1053375612 9:37603549-37603571 ATTGCAGTGGGGGAGGTGGGTGG + Intronic
1053487721 9:38472460-38472482 GTTTCAGTGGTGAGGGCAGAGGG - Intergenic
1054468381 9:65513983-65514005 GTGTTTGTGGGGGGGGGGGGTGG - Intergenic
1055343504 9:75310057-75310079 CTTCCAGTGGGGGTGGAGGGAGG - Intergenic
1055346931 9:75349756-75349778 GTTCCAGTGGAGGTGGCGAGGGG + Intergenic
1055688025 9:78798790-78798812 TTTTCAGAGGGTGGGGAGGGAGG + Intergenic
1056239473 9:84630012-84630034 GTTTCAGTGCAGGGGGTGGGCGG - Intergenic
1056324205 9:85463102-85463124 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1056726967 9:89127777-89127799 TTCTCAGTGGTGGGGGGGGGTGG - Intronic
1056971166 9:91204959-91204981 GTTGCAGGGTGGGGGGAGGGGGG + Intergenic
1057709028 9:97420357-97420379 TTTTTTTTGGGGGGGGCGGGTGG + Intronic
1057995729 9:99820545-99820567 GTGTGTGTGGCGGGGGCGGGGGG - Intergenic
1057996614 9:99825192-99825214 ATTTGAGGGGTGGGGGCGGGCGG + Intronic
1058025886 9:100141962-100141984 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1058202481 9:102061698-102061720 GTTGCAGGGGTGGGGGCTGGGGG - Intergenic
1058553814 9:106144407-106144429 GCTTTAGTGGTGGGGGCGGGGGG + Intergenic
1058672958 9:107376175-107376197 GTTTCAGTGGGAAGGTCAGGAGG + Intergenic
1058843630 9:108934325-108934347 CTGTAATTGGGGGGGGCGGGGGG + Exonic
1059014127 9:110495612-110495634 GATACACTGGGGGCGGCGGGGGG - Intronic
1059091429 9:111363109-111363131 CTATCAGTGGGTGGGGTGGGGGG - Intronic
1059164308 9:112064041-112064063 TTTTTTGGGGGGGGGGCGGGTGG + Intronic
1060223581 9:121776895-121776917 GTTTGAGTGGGGAGGGAGAGGGG + Intronic
1060283300 9:122228106-122228128 GTGTCAGGCGGGCGGGCGGGCGG - Intronic
1060632049 9:125167821-125167843 GTTTGAGATGGGGGGGGGGGGGG + Intronic
1060635821 9:125199315-125199337 TTTTTAGTTGGGGGGGGGGGCGG + Intergenic
1061371963 9:130202343-130202365 GTTTCAGGGGGTGGGGGGGAGGG - Intronic
1061485989 9:130920765-130920787 GTTCCAGTGTAGGGGGTGGGAGG - Intronic
1061737088 9:132669250-132669272 TGTTCTTTGGGGGGGGCGGGCGG - Intronic
1061991267 9:134160007-134160029 GTCTCTGTGGGGTGGGAGGGCGG + Intergenic
1062280164 9:135748313-135748335 GCTGCTGTGGGGCGGGCGGGAGG - Intronic
1062344130 9:136107074-136107096 GACTCAGGGCGGGGGGCGGGGGG - Intergenic
1062559137 9:137131694-137131716 GTGTGGGGGGGGGGGGCGGGGGG - Intergenic
1062559141 9:137131698-137131720 GTGTGTGTGGGGGGGGGGGGCGG - Intergenic
1185689110 X:2138701-2138723 CTTCCAGTGGGGGCGGGGGGGGG - Intergenic
1188406472 X:29816767-29816789 ATTTCAGTGGGGGGGGAGGAAGG - Intronic
1188974740 X:36659746-36659768 GTTTCTGCGGGGGGTGGGGGGGG - Intergenic
1189074924 X:37905431-37905453 GTGTGTGTGGGGGGGGCGTGGGG + Intronic
1189365089 X:40381785-40381807 GGTTCAGTGGGGAGGGAGGTAGG - Intergenic
1190159659 X:48022157-48022179 GTATGAATGGGGGGGGGGGGGGG - Intronic
1190286118 X:48962461-48962483 TTCTCAGTGGGGGGGGCAGAAGG + Exonic
1190560377 X:51680652-51680674 CTTTGAGTGGGGGTGGGGGGAGG - Intergenic
1190563914 X:51712669-51712691 CTTTGAGTGGGGGTGGGGGGAGG + Intergenic
1190756219 X:53404317-53404339 GTGGTAGTGGGCGGGGCGGGGGG - Intronic
1190885791 X:54530153-54530175 GTCTCCGCGGGGGGGGGGGGGGG - Intergenic
1191188937 X:57644788-57644810 GTCTCCGGGGGGGGGGGGGGGGG + Intergenic
1191217785 X:57951442-57951464 CTATCAGTGGTGGGGGTGGGTGG + Intergenic
1191805465 X:65130779-65130801 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1192124180 X:68486190-68486212 GTTGCAGGGTGGGGGGAGGGGGG - Intergenic
1192393260 X:70753190-70753212 ATTTGGGTGGGGGGGGTGGGCGG + Intronic
1192881051 X:75284685-75284707 GTTCCAGTGGAGGTGGCAGGGGG + Intronic
1192968132 X:76202067-76202089 GTTCCAGTGGAGGTGGCAGGGGG + Intergenic
1193537427 X:82731501-82731523 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1194882519 X:99271739-99271761 GTTCCAGTGGAGGTGGCAGGGGG + Intergenic
1194912755 X:99667011-99667033 GTTTGTGTGGGCGGGGGGGGGGG + Intergenic
1195268119 X:103203626-103203648 GTTTCTTTGGCGGGGGGGGGGGG - Intergenic
1196440975 X:115719794-115719816 TTTTTAGTCGGGGGGGGGGGCGG + Intergenic
1196669985 X:118355706-118355728 GGTTTAGTTGGGGAGGCGGGTGG + Intronic
1196751902 X:119125888-119125910 GTTTGTGTGGGGGGTGGGGGTGG + Intronic
1196830209 X:119770110-119770132 CTTTCAGAGGTGGAGGCGGGTGG - Intergenic
1197644790 X:129005724-129005746 GTGTGTGTGGGTGGGGCGGGGGG - Intergenic
1197669030 X:129255616-129255638 GTTCCAGTGGAGGTGGCAGGGGG + Intergenic
1198533119 X:137564227-137564249 GTTTCTTTGGGGGGGTAGGGGGG - Intergenic
1199073471 X:143504338-143504360 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1199408038 X:147485616-147485638 GATGCAGTGGGGGTGGGGGGTGG + Intergenic
1199439927 X:147856322-147856344 GTGTCAGTGGAGGGGCCTGGTGG + Intergenic
1199832940 X:151562804-151562826 GGGGCAGCGGGGGGGGCGGGGGG + Intergenic
1200122232 X:153796566-153796588 GTTTCAGACAGGAGGGCGGGTGG + Intronic
1200148503 X:153939904-153939926 ATTTTGGTGGTGGGGGCGGGAGG - Intronic
1200682150 Y:6225422-6225444 GTGTGTGTGGGGGGGGGGGGTGG + Intergenic
1200860089 Y:7982244-7982266 GTGTGTGTGTGGGGGGCGGGGGG - Intergenic