ID: 1174032240

View in Genome Browser
Species Human (GRCh38)
Location 20:47639129-47639151
Sequence GTTACCAAAGCAACCCATGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174032235_1174032240 9 Left 1174032235 20:47639097-47639119 CCTCCAGTAAAAAATATCAGTGC 0: 1
1: 0
2: 2
3: 13
4: 148
Right 1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG 0: 1
1: 0
2: 0
3: 8
4: 97
1174032234_1174032240 30 Left 1174032234 20:47639076-47639098 CCTGTTTCTGTTGGCTCAAGTCC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG 0: 1
1: 0
2: 0
3: 8
4: 97
1174032236_1174032240 6 Left 1174032236 20:47639100-47639122 CCAGTAAAAAATATCAGTGCTTT 0: 1
1: 0
2: 4
3: 20
4: 285
Right 1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174032240 Original CRISPR GTTACCAAAGCAACCCATGT TGG Exonic
907214191 1:52848300-52848322 GTCACCAAAACAAAGCATGTCGG - Intronic
910607147 1:89099550-89099572 GCTTCCAAAGGTACCCATGTTGG + Intergenic
912158858 1:106956260-106956282 GTGACCAAAGTAACCAATTTAGG + Intergenic
920570455 1:207012833-207012855 GTTACCAATGACATCCATGTTGG - Intronic
921873008 1:220161535-220161557 GTTCCCAAAGCTACTCATGCTGG + Intronic
1070261158 10:74857234-74857256 TTAACCTAAGAAACCCATGTTGG - Intronic
1070609759 10:77925653-77925675 GTTTCCAAAGAAACCCAGGCAGG + Intronic
1074020004 10:109572848-109572870 GATACCAAAGATACCCATGGAGG + Intergenic
1078561935 11:12379773-12379795 GTTACCAAAATAACCAATGTGGG - Intronic
1079422900 11:20311088-20311110 ATTACCAAAGCCACCCAGGCAGG + Intergenic
1083835315 11:65262705-65262727 GGTAACAAAGCAACAGATGTGGG + Intronic
1086106905 11:83156870-83156892 GTTACCATAACAACCCATTCAGG - Intergenic
1088515904 11:110633294-110633316 GGTACCAAAGCAATCCATTGAGG - Intronic
1088662721 11:112064566-112064588 GTTCCTGAAGCACCCCATGTTGG + Intronic
1090226554 11:125075441-125075463 GTTCCCAAAGGCACACATGTGGG - Intronic
1090443004 11:126739694-126739716 GTGACCAGAGCATCCCTTGTGGG - Intronic
1091386711 12:100617-100639 GTTACTGAAGCCAACCATGTTGG + Intronic
1096953081 12:55495860-55495882 GTTACCAAAAAAACCTATGTTGG - Intergenic
1101233512 12:102765788-102765810 GTTACCAAAGCCTCCTCTGTAGG + Intergenic
1104799302 12:131542723-131542745 GTCACCAAAGCAGCCCTGGTAGG - Intergenic
1109092826 13:58070316-58070338 CTTGCCAAAGCAGCCCATTTTGG + Intergenic
1112129874 13:96511012-96511034 GTTTCCAAAGCATCCCATTTTGG - Intronic
1116102729 14:40462934-40462956 GGTAAAAAAGTAACCCATGTAGG + Intergenic
1117983080 14:61361041-61361063 GTTCCCGAAGCCACCCAGGTGGG - Intronic
1122689738 14:103526474-103526496 GCTGCCAAAGCAGCCCCTGTGGG - Intergenic
1127741666 15:61914178-61914200 GTTGCCAAAGCATCACCTGTTGG + Intronic
1128446927 15:67770975-67770997 ATTTCCAAAGCATGCCATGTCGG + Intronic
1136049977 16:27643277-27643299 GTTCTCAAAGCAACCCAAGGGGG - Intronic
1139156424 16:64448213-64448235 GTGACCAAAGCTATCCACGTGGG - Intergenic
1149724259 17:58877217-58877239 GGTACCAAGGCTACCTATGTTGG - Intronic
1150269347 17:63852948-63852970 GTTACCGAACCAAACCAGGTCGG - Intergenic
1151279133 17:73058871-73058893 ACTACCAAAGCAACACATTTTGG + Intronic
1155089726 18:22494746-22494768 GTTTCCAAAGCTATTCATGTAGG + Intergenic
1157459821 18:47880398-47880420 GTTGCCAAAGCAACCCAGTAGGG - Intronic
1159107909 18:64025260-64025282 GATACCAGAGTAAACCATGTTGG - Intergenic
1159390848 18:67790026-67790048 GATACAAAAGCAACCCAAGTGGG - Intergenic
1160623632 18:80188321-80188343 GTTCCCCAAGACACCCATGTAGG - Intronic
1166013466 19:39961239-39961261 TTTAAAAAAGCAACCCAAGTGGG - Intergenic
929153099 2:38765899-38765921 GTAACCAAAACAGCCCATGATGG + Intronic
932202248 2:69840428-69840450 ATTTACAAAGCAAACCATGTGGG + Intronic
933222588 2:79707467-79707489 GTTACCAAAGCTACATCTGTTGG - Intronic
933839718 2:86276581-86276603 GTTCCGAAAGCAACCAAGGTGGG + Intronic
936417979 2:112336921-112336943 GTTAACAAAGCACCCACTGTAGG - Exonic
940046576 2:149416405-149416427 GAAACCGAGGCAACCCATGTGGG - Intronic
942173640 2:173310392-173310414 ATTTCCCGAGCAACCCATGTAGG - Intergenic
942288567 2:174446634-174446656 GTAAACACAGCAACACATGTCGG + Exonic
945515267 2:210756128-210756150 GTAACAAACACAACCCATGTGGG + Intergenic
947579993 2:231309298-231309320 GTTTCCAAGGCAACCGATGTTGG - Intronic
947922793 2:233892967-233892989 GTAACCAAAGCAATCCCTGGAGG - Intergenic
1171203469 20:23260382-23260404 GGTTCCAGAGCAAACCATGTGGG - Intergenic
1172382936 20:34512004-34512026 GATAACAAAGGAACCCATTTAGG - Intergenic
1174032240 20:47639129-47639151 GTTACCAAAGCAACCCATGTTGG + Exonic
1175290765 20:57873647-57873669 GTTCCCAAGGCAAGTCATGTGGG + Intergenic
1175480534 20:59307514-59307536 GTCACCTAAGAAGCCCATGTTGG - Intronic
1178592658 21:33924499-33924521 CTTCCCATAGCAACCCAGGTTGG + Intergenic
1179080168 21:38163390-38163412 TCTACCAAATAAACCCATGTAGG - Intronic
1179711209 21:43264218-43264240 GTCTCCAAACCAGCCCATGTTGG - Intergenic
949439521 3:4065793-4065815 GTTACTATAGCAATCCTTGTTGG - Intronic
951928625 3:27938344-27938366 TTCACAAAAGCAACCTATGTGGG - Intergenic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
963930381 3:150998474-150998496 GTCACCAAATCAACCCAAATAGG + Intergenic
965041003 3:163507021-163507043 GTTATTAAACCCACCCATGTAGG + Intergenic
965366346 3:167804949-167804971 GTTTCCACAGCAAGCCATATTGG - Intronic
967967249 3:194971732-194971754 GTTGTCAAAGCAACCCCTGCAGG + Intergenic
972031148 4:34459797-34459819 CTTACCAAAGAGACACATGTAGG - Intergenic
973652933 4:53014832-53014854 TGTACCAAAGCAAGCTATGTAGG - Intronic
981078672 4:140616805-140616827 GTTACCACAGGAACCCAAGTAGG - Intergenic
982937464 4:161500250-161500272 GTTAATAAAGCAAACCATATGGG + Intronic
984551601 4:181166646-181166668 GAGACAAAAGCAACCCATATGGG + Intergenic
985848886 5:2374115-2374137 GTGAGCAAAGCAACACATCTGGG - Intergenic
989658270 5:43768944-43768966 CTTACCCAAGTAACCAATGTTGG - Intergenic
991635583 5:68701524-68701546 CTTACCAGAGCAACCCTTTTTGG - Intergenic
993279169 5:85903597-85903619 GATAACAGAGCAACCCAGGTAGG + Intergenic
993291232 5:86074082-86074104 GTTTCCAAATCAACCCACTTTGG - Intergenic
997429018 5:133824707-133824729 GTTGCCAAAGCAACCAAGTTTGG + Intergenic
1006270277 6:32960141-32960163 GTTTCCAAAGCACCCTGTGTTGG + Intronic
1013481834 6:110559518-110559540 TTAACCAAAGCAAAACATGTAGG - Intergenic
1013902039 6:115168484-115168506 GCCACAAAAGCAACTCATGTAGG + Intergenic
1016037285 6:139396355-139396377 ATTAGCATAGCAACCAATGTGGG - Intergenic
1016460297 6:144274640-144274662 GTAATGAAAGCCACCCATGTAGG - Intergenic
1020537565 7:9420981-9421003 GCCACCAAAGCAATGCATGTGGG - Intergenic
1021582731 7:22174288-22174310 GTGAGCAAAGCAACGGATGTGGG + Intronic
1023609672 7:41960155-41960177 GTTACAAAAGCAAAGCATCTTGG + Intergenic
1027489204 7:78801539-78801561 GTTACCTCTGCAAACCATGTAGG + Intronic
1028303521 7:89232719-89232741 GTCACCAAAGCAAATAATGTAGG - Intronic
1029436720 7:100567896-100567918 GTTGCCAAGGCAACTGATGTAGG + Exonic
1035922086 8:3688027-3688049 GTGAGCAAAGCAATCCATTTCGG - Intronic
1037048421 8:14338373-14338395 GTTACATAAGCTACCCACGTGGG - Intronic
1038520916 8:28231182-28231204 GTTTTCAATGCAAGCCATGTAGG + Intergenic
1041556295 8:59160023-59160045 GTTACAAAAGACACCCATGTTGG - Intergenic
1041683602 8:60620707-60620729 GCTACCAATGCAACACATGCAGG + Exonic
1043159909 8:76833444-76833466 GTAACAAAAGCAACTCATTTAGG - Intronic
1044554188 8:93544227-93544249 GTTAACTAATTAACCCATGTTGG + Intergenic
1049911255 9:270544-270566 GGGAGCAAAGCAAACCATGTAGG + Intronic
1056748707 9:89328790-89328812 GATACAGAAGCAACCCAAGTGGG + Exonic
1057801753 9:98195333-98195355 ATTAACAAAGCCAGCCATGTGGG - Intergenic
1059315684 9:113424023-113424045 GTTACCAAATGAACACTTGTTGG + Intronic
1060539401 9:124419615-124419637 GATACCAAAGAAACCCAGGTAGG - Intergenic
1062293277 9:135807761-135807783 TTTACCAAAGCAACATATGATGG - Intergenic
1186173620 X:6902820-6902842 GTTACAAAAGCTTGCCATGTAGG + Intergenic
1186398370 X:9233597-9233619 GTTGCCACAGCAACACAAGTTGG - Intergenic
1186959635 X:14721903-14721925 GTTACCACAGGAAACAATGTTGG + Intronic
1189888212 X:45571565-45571587 CATAACAAAGCAACCCATGCTGG + Intergenic
1194091736 X:89586483-89586505 GTTCCAAAAGGAACCAATGTGGG - Intergenic
1196121947 X:112060815-112060837 GCTAACAAAGCAACCCTTTTGGG - Intronic
1200444373 Y:3242548-3242570 GTTCCAAAAGGAACCAATGTGGG - Intergenic