ID: 1174035075

View in Genome Browser
Species Human (GRCh38)
Location 20:47663823-47663845
Sequence ACTCCCAAGGGGGCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174035068_1174035075 13 Left 1174035068 20:47663787-47663809 CCGGGACCAGAACCTGGGTCTTG 0: 1
1: 0
2: 2
3: 40
4: 307
Right 1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 123
1174035070_1174035075 1 Left 1174035070 20:47663799-47663821 CCTGGGTCTTGTCATTCTACTTT 0: 1
1: 0
2: 1
3: 14
4: 243
Right 1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 123
1174035069_1174035075 7 Left 1174035069 20:47663793-47663815 CCAGAACCTGGGTCTTGTCATTC 0: 1
1: 0
2: 0
3: 19
4: 161
Right 1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 123
1174035065_1174035075 24 Left 1174035065 20:47663776-47663798 CCAAGGCAGAGCCGGGACCAGAA 0: 1
1: 0
2: 5
3: 31
4: 247
Right 1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174035075 Original CRISPR ACTCCCAAGGGGGCACAAGC TGG Intronic
901670272 1:10851916-10851938 ACTCGCGAGTGGGCACAGGCTGG - Intergenic
902805790 1:18860555-18860577 ACGCCCAAGGAGTCAGAAGCGGG + Intronic
904875957 1:33654761-33654783 CTTCCCAAGGGGGCACAACGAGG + Intronic
906477749 1:46181270-46181292 ACTCATAAGGGGACACATGCAGG - Intronic
906677984 1:47707560-47707582 TCTCCCAAGGTTGCACAAGTAGG - Intergenic
908670133 1:66537109-66537131 ATTCCCCAGGGACCACAAGCAGG + Intronic
913524505 1:119678203-119678225 ATTCCCAAGGGAGCATAAACAGG - Intronic
914905841 1:151742957-151742979 TCTCCCAAGGTGGCATAAGTGGG - Intergenic
915131491 1:153698253-153698275 ATTCCTAAGGGGGCACCAGGAGG + Intergenic
916668406 1:166989149-166989171 ACCCGCAAGGCGGCACGAGCCGG + Exonic
919003022 1:191859155-191859177 ACTCCCAAGGGTGAACACTCTGG - Intergenic
1066135298 10:32439700-32439722 ACCCCCAAGGGGGCAAAAATTGG - Intergenic
1069841841 10:71344674-71344696 ACTCCCAAGAGGGCTCACGGGGG + Intronic
1075273688 10:121075343-121075365 ACTCCCAAGGGTACACAAGTTGG - Intergenic
1083304864 11:61756901-61756923 ACTCCCAAGGGGTTACAGACTGG + Intronic
1090036341 11:123252773-123252795 TTTCCCATGGGGGCAAAAGCAGG - Intergenic
1090611348 11:128473813-128473835 AGTGCCAAGGGGGCAAAGGCAGG + Intronic
1096489108 12:52004111-52004133 CCTCCCAAGAGGGCACAACTGGG - Intergenic
1096519666 12:52177517-52177539 TCTCCCCTGGGGGCACAGGCTGG - Intronic
1097262196 12:57726209-57726231 CGCCCCTAGGGGGCACAAGCGGG + Intronic
1098288441 12:68932954-68932976 CCTCCTAAGGAGGCAAAAGCTGG + Intronic
1102001876 12:109562501-109562523 GCTCCCATGGGGGCAGCAGCTGG + Intronic
1102490572 12:113287651-113287673 TCTCCCAAGGCGGGACAGGCGGG + Intronic
1102513973 12:113434362-113434384 ATTCACAAGGGGGCAGAAGTGGG - Intronic
1107996382 13:45865240-45865262 AGTCCCAACTGGGCACCAGCAGG - Intergenic
1108492294 13:50993655-50993677 ATTCCCAGGAGGGCACAGGCAGG - Intergenic
1111084556 13:83357907-83357929 ACTCTCATGGGGACAAAAGCAGG + Intergenic
1112726530 13:102310858-102310880 ACCCCCAAGGGAGAACAATCTGG - Intronic
1120246482 14:82012017-82012039 ACTGCCAAGGTGGCTCAGGCTGG - Intergenic
1121818517 14:96946462-96946484 ACTCACAAGGTGGCATTAGCAGG - Intergenic
1122961754 14:105097122-105097144 ACTCAGAAGGGGGCAGAGGCAGG - Intergenic
1126736409 15:51736315-51736337 ACTCCCAAGAGGGCAGAATGGGG + Intronic
1129523554 15:76200426-76200448 CCTGCCATGGGGGCTCAAGCAGG - Intronic
1131360994 15:91790482-91790504 ACTCCCAAGGAGGCTGAAGAGGG - Intergenic
1134694672 16:16214714-16214736 ACTACTAAGGAGGCAGAAGCAGG - Intronic
1134977161 16:18579924-18579946 ACTACTAAGGAGGCAGAAGCAGG + Intergenic
1137708644 16:50551502-50551524 ACTCCCAAGGAGACAGAGGCCGG - Intronic
1138584482 16:57961054-57961076 ACTCTCAAAGGGCCCCAAGCGGG + Intronic
1141847560 16:86621407-86621429 GCTCCGAAGGGTGCACAGGCTGG - Intergenic
1142066655 16:88066832-88066854 TCTCCCAAGGGAGCACGAGAGGG - Intronic
1143659648 17:8316553-8316575 ACCCCCAAGGGGGCAAAAATTGG + Intronic
1143668069 17:8376131-8376153 CCTCCAAAGGGGGTACAGGCAGG - Intronic
1144236778 17:13269264-13269286 TCTCCCAAGGAGGCAGAAGTGGG - Intergenic
1144662169 17:17078177-17078199 ACTCCCAAACAGACACAAGCAGG - Intronic
1149869536 17:60169445-60169467 CCTCCCAAGGGGGTACCATCTGG + Intronic
1151898788 17:76998003-76998025 ACTCCCGACGGCTCACAAGCAGG - Intergenic
1152318106 17:79592711-79592733 ACTCCCAAGGTGGCCCCAGCAGG + Intergenic
1152786020 17:82248523-82248545 ACCCACAATGGGGCGCAAGCAGG + Intronic
1154073600 18:11177972-11177994 ACTCCGATGGGGACACAAGGTGG + Intergenic
1161107783 19:2453224-2453246 AGTCCCCTGGGGGCAGAAGCTGG + Intronic
1161390078 19:4016157-4016179 ACTCCCCAGGTGGCGCAGGCTGG - Intronic
1161704783 19:5814534-5814556 ACTCCCCAGGGGACACCTGCCGG - Intergenic
1162751699 19:12833689-12833711 GCTCCCATGGGGGCACCAGGAGG + Intronic
1166664674 19:44671893-44671915 AATGCCAAGGGGCCACGAGCTGG - Exonic
927871520 2:26627299-26627321 ACTTCCAAGGGGCCACATGATGG - Intronic
931494540 2:62788292-62788314 ACTCCCTAGTGGGCAGAAGTTGG - Intronic
931903733 2:66820663-66820685 ACTCTCAAGGAGCCACAAGAAGG + Intergenic
932771543 2:74503286-74503308 TCTCCCAAGGTGGCTGAAGCTGG - Intronic
935185011 2:100723940-100723962 ACTTCTAAGAGGGCAGAAGCAGG - Intergenic
935348055 2:102127019-102127041 ACACCCAAGGGTTCACAAGAGGG - Intronic
936573558 2:113635487-113635509 TTTCCCTAGGGGGCACATGCTGG + Intronic
936980464 2:118260304-118260326 ACTCACCAGGGGGAACAAACAGG + Intergenic
938637964 2:133249785-133249807 ACGCCCAAGGGAACACAAGGTGG + Intronic
940254323 2:151713130-151713152 ACTTCCATGGGGCCACAAACTGG + Intronic
941405599 2:165083766-165083788 GCTCCAGAGGGGGCACAACCTGG + Intergenic
1170150681 20:13222503-13222525 ATGACCAAGGGGGCACAAGGGGG - Intronic
1173139606 20:40470696-40470718 ACTCCCAGGGGGGCAGGCGCTGG - Intergenic
1174035075 20:47663823-47663845 ACTCCCAAGGGGGCACAAGCTGG + Intronic
1177775591 21:25562419-25562441 AGTCCCCAGGGGGCACCCGCAGG - Intergenic
1179487405 21:41719266-41719288 ACACCCAAGGGGGCAGAGCCAGG - Intergenic
1179867945 21:44227964-44227986 AGTCCCAAGGGGGCAGGAGACGG - Intronic
1180995654 22:19963962-19963984 ACTGCCAAGGTGGCACCAGGAGG + Intronic
1181629830 22:24144873-24144895 ACTCCCATAGGGGCTCAGGCAGG - Intronic
1181690114 22:24554698-24554720 GCTCCCAAGGCGGCTCCAGCAGG + Intronic
1182103442 22:27672791-27672813 TCTCCCAAGAGGTCACAACCTGG + Intergenic
1183282363 22:36938454-36938476 CCTCCCAAGGGGGCAGAGACAGG - Exonic
1183476556 22:38038977-38038999 ACTCCCTGGGGGGCGCAAGGTGG - Intronic
1183686128 22:39362386-39362408 ACTTCCAAGGCTGCACAACCCGG + Intronic
955135239 3:56210956-56210978 ACCACCAAGGGGGCAAAAGTTGG + Intronic
961325507 3:126106986-126107008 ACTCAGCAGGCGGCACAAGCGGG + Intronic
965616894 3:170603167-170603189 AAGCCAAAGGGGCCACAAGCAGG - Intronic
966634850 3:182121160-182121182 ACTCTCAAGGGAACAAAAGCTGG + Intergenic
967032293 3:185619270-185619292 AATACCAAGGGAGCAAAAGCTGG - Intronic
968689380 4:1982829-1982851 ACTCCCAGGCAGGCACAGGCAGG + Exonic
969036209 4:4255943-4255965 ACTCCCAGGGGAGCAGCAGCAGG + Intergenic
973283002 4:48380370-48380392 ATTCCCAAGAGGGCAAAAACTGG - Intronic
984920281 4:184757991-184758013 TCTCCCAGGGGGCCACAAGATGG - Intronic
985963252 5:3319817-3319839 GCTCTCAAGGAGGCACAGGCTGG + Intergenic
992180843 5:74196987-74197009 ATACCCAAGGGGGCTCCAGCAGG - Intergenic
996164206 5:120205195-120205217 AGACCTAAGGGGGCACAAGTAGG - Intergenic
997250023 5:132381423-132381445 CCTTCCAAGGGGGCACAGACAGG - Intronic
997524910 5:134546278-134546300 ACTACCTGGGGGGCTCAAGCGGG - Intronic
998367840 5:141642342-141642364 ACTCCAAAGGGGGCAAAGGTAGG + Intronic
1000037559 5:157460441-157460463 CCTCCCAGGGGGGCCAAAGCTGG + Intronic
1000164047 5:158629967-158629989 ACTCCGATGGGGGCATAAGATGG - Intergenic
1003893523 6:10584982-10585004 ACACCCTTGGGGGCACAGGCAGG - Intronic
1006028295 6:31161469-31161491 ACTCCCAAGAGGTCACAGGCTGG + Exonic
1014300165 6:119671647-119671669 ACTTTCAAGGGGGCAGAAGAAGG + Intergenic
1015268630 6:131316132-131316154 GCTCCTAAGGGGGCTGAAGCAGG - Intergenic
1020115774 7:5475590-5475612 ACTCCCCAGGGGGCATCAGGAGG - Intronic
1023106140 7:36764891-36764913 ACTCCCAAACTGGCACAAACAGG - Intergenic
1026479251 7:70764221-70764243 ACGGCCGAGGGGGCAGAAGCCGG - Intronic
1029993485 7:104984064-104984086 ACCCCCAGGGCCGCACAAGCCGG - Intergenic
1033418383 7:141184578-141184600 ACACCCAAGGCAGCACAAGTAGG - Intronic
1033629930 7:143147643-143147665 ACTCCAAAGGGGACACATTCTGG + Intergenic
1035742056 8:1935869-1935891 ACGCCCATGGGGGCACGTGCAGG + Intronic
1038749519 8:30282702-30282724 GCTCTTAACGGGGCACAAGCAGG - Intergenic
1041827259 8:62109891-62109913 AGACCCAAGGGGGCACATGAAGG + Intergenic
1047306274 8:123655334-123655356 AGACCCATGGAGGCACAAGCAGG + Intergenic
1047340617 8:123976958-123976980 CCTGCCAAGGGGACACAATCAGG - Intronic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1048729217 8:137418976-137418998 AGTCCCAAGGCTGCACATGCAGG + Intergenic
1049640477 8:143712904-143712926 ACTCCCAAGGGGCCCCATGCAGG - Intronic
1049662326 8:143825008-143825030 ACACCTAAGGGGGCACAGGAAGG + Intronic
1051894702 9:21975099-21975121 TCTCCCCCGGGGGCACCAGCCGG + Intronic
1057733613 9:97633195-97633217 TTTCCCAAGGCGGCAAAAGCCGG + Intronic
1059108278 9:111530608-111530630 ACTCCCCAGCAGGCACCAGCTGG - Intronic
1060918682 9:127405751-127405773 ACTCCCAAGGGGTCACAGCCTGG - Intronic
1061780018 9:132989922-132989944 TCTGCCCAGGGGGCACAGGCAGG - Intronic
1062375592 9:136260470-136260492 AGTCTCAAGGGGCCACATGCTGG - Intergenic
1062389386 9:136327916-136327938 ACGCCCACGCGGGCACACGCCGG - Intronic
1186575939 X:10766086-10766108 ACACCCAAGGGGAGACAGGCAGG + Intronic
1187411501 X:19054391-19054413 TCTCCCTAGGGGTCACAGGCTGG + Intronic
1193707902 X:84845065-84845087 AGTCCCTAGGCTGCACAAGCAGG + Intergenic
1193711315 X:84883861-84883883 AGTCCCTAGGCTGCACAAGCAGG - Intergenic
1198522123 X:137463527-137463549 ACTCCCAAGGTGACACAACTGGG - Intergenic
1200184541 X:154173744-154173766 AGTCTCACGGAGGCACAAGCAGG - Intergenic
1200201600 X:154285802-154285824 AGTCTCACGGAGGCACAAGCAGG - Intronic
1200269000 X:154663323-154663345 AGACCCAAGGGGGCACATGAAGG - Intergenic