ID: 1174035410

View in Genome Browser
Species Human (GRCh38)
Location 20:47665612-47665634
Sequence ACTTCTTGTAAGTCAAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174035399_1174035410 24 Left 1174035399 20:47665565-47665587 CCTCCAGTGTCTCCCCTGGGTTT 0: 1
1: 0
2: 5
3: 28
4: 263
Right 1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1174035405_1174035410 -8 Left 1174035405 20:47665597-47665619 CCTCCTGTAGCGTAGACTTCTTG 0: 1
1: 0
2: 0
3: 1
4: 64
Right 1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1174035402_1174035410 12 Left 1174035402 20:47665577-47665599 CCCCTGGGTTTGATGAAAGGCCT 0: 1
1: 0
2: 0
3: 13
4: 131
Right 1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1174035400_1174035410 21 Left 1174035400 20:47665568-47665590 CCAGTGTCTCCCCTGGGTTTGAT 0: 1
1: 0
2: 3
3: 16
4: 180
Right 1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1174035403_1174035410 11 Left 1174035403 20:47665578-47665600 CCCTGGGTTTGATGAAAGGCCTC 0: 1
1: 0
2: 0
3: 9
4: 113
Right 1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1174035404_1174035410 10 Left 1174035404 20:47665579-47665601 CCTGGGTTTGATGAAAGGCCTCC 0: 1
1: 0
2: 2
3: 5
4: 105
Right 1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174035410 Original CRISPR ACTTCTTGTAAGTCAAAAGG GGG Intronic
901659959 1:10793012-10793034 ACTTCTTTTAAATTAAAAAGGGG + Intronic
902561523 1:17280568-17280590 ACTTCTTCTGGGTCAAAAGAGGG - Intronic
904302654 1:29565065-29565087 ACTTCTTATAAGTCAAAAGTGGG + Intergenic
905954639 1:41981996-41982018 ACTTCTTGTAAATGAGAAGGTGG + Intronic
907653134 1:56315534-56315556 ATTTATAGTAAGTCAAATGGTGG + Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
913683505 1:121209374-121209396 ACTTTTAGTGATTCAAAAGGAGG - Intronic
914035345 1:143996998-143997020 ACTTTTAGTGATTCAAAAGGAGG - Intergenic
914154107 1:145070972-145070994 ACTTTTAGTGATTCAAAAGGAGG + Intronic
914951067 1:152114689-152114711 ACTTCTTCCTAGTCAAAAGATGG + Intronic
916483760 1:165238492-165238514 ACCTCTTCTAAGGCAATAGGAGG - Intronic
917270616 1:173269431-173269453 GCTTCTTTTAAGTGAAAACGTGG - Intergenic
917278419 1:173355665-173355687 ACTTGTTGTAGGTCAAAGAGGGG - Intergenic
918037667 1:180891339-180891361 AATTCTTCTAAGGGAAAAGGTGG - Intergenic
919150678 1:193693826-193693848 ACTTCTTGTGAGTCAAGATAAGG - Intergenic
919966835 1:202535642-202535664 ATTTCTTGTAGGTAAAAAAGAGG - Intronic
920470811 1:206227883-206227905 ACTTTTAGTGATTCAAAAGGAGG - Intronic
921359844 1:214320774-214320796 ATTCCTTGTAGGTGAAAAGGTGG + Intronic
921476081 1:215611958-215611980 ATGTTTTGTAAGACAAAAGGTGG - Intronic
922053608 1:222019150-222019172 ACTTGTTGAAAGTCAAAGGAAGG + Intergenic
923962270 1:239099016-239099038 ACTCCTTGTAAGTCAAGTCGGGG - Intergenic
924136220 1:240970071-240970093 AGTTCTTGTAAGTAGGAAGGGGG - Intronic
1063338814 10:5243876-5243898 ACTTCTTGGGAGACAAAGGGAGG + Intergenic
1065263762 10:23954176-23954198 TCTTCTAGTAAGTCAATAGACGG + Intronic
1066215570 10:33283364-33283386 AATTCTATTAAGTCAGAAGGTGG + Intronic
1066907724 10:41235091-41235113 ACTTTTTGTAAGTCTGCAGGTGG + Intergenic
1067760443 10:49041039-49041061 ACTTTGTGTGAGTCAACAGGTGG + Intronic
1069868391 10:71518361-71518383 ACTTATTGCAAATCAAAAGCAGG - Intronic
1070169560 10:73922370-73922392 ACTTCATCTAATTCAAAGGGAGG - Intronic
1071398855 10:85249827-85249849 ACTTTCTGTAAGCCAAAAAGTGG - Intergenic
1074209628 10:111318416-111318438 ACTTCCTGAAAGTCACAAAGTGG - Intergenic
1076791335 10:132778483-132778505 ACTCCTTGTATGTTAAAATGTGG - Intronic
1078109982 11:8384572-8384594 TCTTCTAGGAAGTTAAAAGGAGG - Intergenic
1081624529 11:44641852-44641874 AATTCTTTTAATTCAAAATGAGG + Intergenic
1084056126 11:66634548-66634570 ACTTCTTGATAGCCGAAAGGAGG - Intronic
1085687954 11:78641476-78641498 ACTTCTAGTAAGACAAAAAAGGG - Intergenic
1087827125 11:102778208-102778230 TCTACTTTTAAGTAAAAAGGAGG + Intronic
1088040953 11:105380923-105380945 ATTTCATGTATATCAAAAGGAGG - Intergenic
1088832102 11:113546090-113546112 GCTTCCTTTAAGTGAAAAGGTGG + Intergenic
1091868885 12:3870119-3870141 ACTTCTGGTAAGTGAAATTGTGG + Intronic
1092087681 12:5777154-5777176 ACTTCTTGTCTGTTAAAAAGTGG - Intronic
1095393657 12:41739340-41739362 ATTTGATGTAAGTCATAAGGGGG + Intergenic
1095570657 12:43681539-43681561 AAGTCTAGTGAGTCAAAAGGGGG + Intergenic
1096420170 12:51450151-51450173 ACTAGTTGTAAGTCATGAGGAGG - Intronic
1096593647 12:52679885-52679907 ACTTCTTGTATGCCACCAGGAGG + Exonic
1098640637 12:72834987-72835009 ACTTTCTGTAAGTCAGAAGTAGG + Intergenic
1099169659 12:79348556-79348578 ACTTCTTGAAAGTCAGGAAGAGG + Intronic
1099352105 12:81585604-81585626 CCTTCTTGTAAGACAAAATGTGG - Intronic
1100607289 12:96162169-96162191 ACTTCATGTTAGGCAAAATGAGG + Intergenic
1102738059 12:115180759-115180781 AATGCTTGTAAGTCAAGAAGAGG + Intergenic
1105680576 13:22723223-22723245 ACTTCCTTAAAGTCAAAGGGGGG - Intergenic
1106593269 13:31116005-31116027 CCTTTTTGTTGGTCAAAAGGAGG - Intergenic
1109681719 13:65759845-65759867 ACTTGTTGTTAGTCTAATGGGGG - Intergenic
1110929698 13:81199380-81199402 ATTTCAAGTTAGTCAAAAGGAGG - Intergenic
1113166518 13:107449349-107449371 ACTTCCTGAAAATCAAAAGTAGG + Intronic
1114271834 14:21104894-21104916 TTTTCTTGAAAGTCAGAAGGTGG + Intergenic
1116549900 14:46223967-46223989 ACTTCATGAAAGTCATAATGTGG - Intergenic
1118685092 14:68283142-68283164 CCTCCTTGTAAATCAAAGGGAGG + Intronic
1126299576 15:47181197-47181219 ACTGCTAGTAAGTAAGAAGGAGG - Intergenic
1129063107 15:72876900-72876922 AATTCATGTAAGTCAAAAAAAGG - Intergenic
1129063109 15:72876945-72876967 AATTCATGTAAGTCAAAAAAAGG - Intergenic
1130751672 15:86719222-86719244 AGTTCTTGTAGGTCAACTGGGGG - Intronic
1133496017 16:6318347-6318369 AGGTTTTGTAAGTAAAAAGGTGG + Intronic
1133654343 16:7845271-7845293 AGTTCCTGTGAGTCCAAAGGGGG + Intergenic
1138964150 16:62063739-62063761 ACATGTTGTATGTCAAAATGAGG - Intergenic
1141318580 16:82985248-82985270 ACTTCTTTTGAATCTAAAGGAGG + Intronic
1142815193 17:2419784-2419806 ACTCCCTGTAACTCAAAAAGCGG + Exonic
1142909354 17:3073907-3073929 ACTTCTGGTAAGTCAAAGCCAGG - Intergenic
1143427444 17:6851314-6851336 ACTTTTTGTCATTAAAAAGGAGG + Intergenic
1143774265 17:9187414-9187436 ACTTCATGATAGCCAAAAGGTGG + Intronic
1149159198 17:53669758-53669780 ACATCTGATAATTCAAAAGGAGG + Intergenic
1155395795 18:25385704-25385726 ACTTCTTCTCACTCAAAAGTGGG + Intergenic
1157061413 18:44295257-44295279 ATGTCTTGTTAGTCACAAGGGGG + Intergenic
1164435697 19:28227246-28227268 GCTTCCTGTCAGTCAAAAGGTGG - Intergenic
1165167329 19:33866032-33866054 AATTCTTAGAAGTCACAAGGGGG - Intergenic
925073992 2:996476-996498 ACTTCATCTAAATCAAAAGTGGG + Intronic
926374411 2:12212126-12212148 ACTCCTTGTAAGTAATCAGGGGG - Intergenic
929479002 2:42284085-42284107 AATTCTTGTAAGTCAAACTGAGG - Intronic
931091691 2:58893333-58893355 ACTTCTTGGAGGACATAAGGTGG + Intergenic
931771568 2:65502208-65502230 ACTTCTTAAAAGTCAACAGCAGG - Intergenic
932490962 2:72120091-72120113 ATTTCTTGTAATTCAACAGATGG + Intergenic
933014807 2:77111791-77111813 ACTTTCTTTAAGTAAAAAGGTGG + Intronic
934879537 2:97963322-97963344 ATTTCTTGTATGTTAAAAGTGGG + Intronic
935291779 2:101617235-101617257 GCTTCTTGTCCGTAAAAAGGGGG + Intergenic
937232175 2:120404632-120404654 ACTTTCTGTGAGTCCAAAGGTGG - Intergenic
937948040 2:127359384-127359406 ACTTTTTGAAGGTGAAAAGGAGG - Intronic
940641219 2:156346223-156346245 ACTTCTCGTAAGTCAGAACAGGG + Intergenic
941591183 2:167422451-167422473 GCAACTTGCAAGTCAAAAGGGGG - Intergenic
942254861 2:174086508-174086530 GCTTCCTTTAAGTGAAAAGGTGG - Intronic
1174035410 20:47665612-47665634 ACTTCTTGTAAGTCAAAAGGGGG + Intronic
1179782755 21:43712852-43712874 ACTTTTTGTCAGGCAAAGGGTGG - Intergenic
1180335092 22:11570411-11570433 ACTTTTGTTAAGTAAAAAGGTGG - Intergenic
1183673710 22:39288460-39288482 ACTTTTTGAAAGTTAAAATGAGG - Intergenic
952524260 3:34193659-34193681 GCTTCCTTTAAGTGAAAAGGTGG + Intergenic
954846082 3:53557764-53557786 ATTTATTGTAAGTCATAAAGCGG + Intronic
957375493 3:79351819-79351841 ACTTCTGGGAAATTAAAAGGAGG + Intronic
958796494 3:98711745-98711767 ACTTTTTTTAAGTTAAAAAGTGG + Intergenic
959751917 3:109847817-109847839 TCTTCTTCTAGGTCAACAGGAGG - Intergenic
960108023 3:113818875-113818897 CCTGCTTGTAAGTCAAAAATCGG + Intergenic
960844141 3:121991276-121991298 ACTTCTTGTAAGTGAGAAAAGGG - Intronic
963741296 3:149084785-149084807 ACATCTTGGAATTCAAAACGTGG + Exonic
963887023 3:150594350-150594372 ACTTCTTATAGGTCAGAGGGAGG - Intronic
964015149 3:151936016-151936038 ACTTGTTATCAGTCAATAGGTGG - Intergenic
964328630 3:155575602-155575624 CTTTATTGTAAGTCAAAAGTAGG - Intronic
964839902 3:160982098-160982120 ATTTCTTGGAAGTCCAAAGCTGG + Intronic
965888765 3:173483333-173483355 ACTTTTTATAACTCAATAGGAGG + Intronic
966496092 3:180582565-180582587 AGTTTATGAAAGTCAAAAGGTGG - Intergenic
967127105 3:186434502-186434524 CCTTCTTGATAGCCAAAAGGTGG - Intergenic
970605795 4:17681134-17681156 ACTTCTTGTTAGTAAAACAGTGG - Intronic
972811710 4:42595850-42595872 ACTCATTGTAAGACAAAAGAAGG + Intronic
975339645 4:73225189-73225211 ACTTGTTTTAAGTCTAAAGATGG - Intronic
975471021 4:74768324-74768346 ATTTCATAAAAGTCAAAAGGTGG + Intronic
978111285 4:104966907-104966929 ACTCTTTGTCAATCAAAAGGAGG - Intergenic
978285993 4:107077263-107077285 ACTGCTTGAAGGTCAAAAGTAGG + Intronic
978542021 4:109827411-109827433 TCTTCTTGTAAATAAAAATGAGG - Intergenic
981998405 4:151000398-151000420 ACTTTTTTTAAGTGAATAGGTGG - Intronic
982144322 4:152366474-152366496 ATTTCTTGTCAGTAAAATGGAGG - Intronic
984385410 4:179049686-179049708 AGTTCTTGTGAGTCAAAATGTGG + Intergenic
989368858 5:40683852-40683874 ATTTCTTGTTAGTTAAAATGTGG - Intronic
991593548 5:68279173-68279195 ACTGCATGTAAGTTAAAATGAGG - Intronic
994803281 5:104408228-104408250 ATCTCTTGTAAGTCATAAGCAGG + Intergenic
996015037 5:118523970-118523992 ACTACTTGTAAGAACAAAGGTGG - Intergenic
996889927 5:128406461-128406483 ACTTCTTTTAAGTGAACAGGTGG - Intronic
997195532 5:131976847-131976869 TCTGCCTGTAAGTCTAAAGGTGG - Intronic
1009961107 6:70522262-70522284 ATTTATTTTAAGACAAAAGGTGG + Intronic
1010299964 6:74248045-74248067 ACTTTTTGTAATTAAAAAAGTGG - Intergenic
1011846554 6:91570739-91570761 ACTTGATCTAAGCCAAAAGGTGG + Intergenic
1011878640 6:91994695-91994717 ACTTCATAACAGTCAAAAGGCGG + Intergenic
1015672145 6:135702912-135702934 ACTTTTCCTAGGTCAAAAGGTGG - Intergenic
1016499799 6:144707084-144707106 AATTTTTGTAATTGAAAAGGAGG - Intronic
1017939801 6:159041779-159041801 GCTTCTGAAAAGTCAAAAGGGGG - Intronic
1018595396 6:165474700-165474722 ACTTCTTGTTAGGCTAAATGAGG + Intronic
1020984398 7:15114148-15114170 GCTTTCTGTAAGTCCAAAGGTGG - Intergenic
1023602254 7:41891684-41891706 ACTTTTTGGAAGTGAAAGGGAGG - Intergenic
1023690841 7:42785894-42785916 ATTTCTTGTAAATCAATAGCTGG - Intergenic
1028996390 7:97105033-97105055 ACTTCTAGGAAGTCAGGAGGGGG + Intergenic
1031903252 7:127432927-127432949 GCTTCTTTAAAGTTAAAAGGAGG + Intergenic
1034519813 7:151611121-151611143 TCTGCTTTTAAGTCAAAAGAAGG + Intronic
1034655830 7:152729166-152729188 AATTCTATTAAGTGAAAAGGAGG - Intergenic
1035031996 7:155866748-155866770 ACTTCTAGGAAGGCAAATGGGGG - Intergenic
1036013430 8:4753865-4753887 ACTTCTTCTAAGCTAGAAGGTGG + Intronic
1036040406 8:5073433-5073455 ACTTCATCTAATTCAAAATGTGG - Intergenic
1037081531 8:14793508-14793530 ATTTCTGGAAACTCAAAAGGTGG + Intronic
1038911713 8:31972195-31972217 ACTCCTTGTGAGTTAGAAGGAGG - Intronic
1039380120 8:37077041-37077063 GCTTCTTGTAAGTAAGAAAGGGG - Intergenic
1039611667 8:38924148-38924170 ACATCTTGTAAGTGAAAACCGGG - Intronic
1042998150 8:74723786-74723808 TCTTCATGTAAGTCAAAACTGGG + Intronic
1046507177 8:115151169-115151191 TCTTCTTGAAACTCAAAAGTTGG + Intergenic
1046774931 8:118153798-118153820 ACTTCTTGTAAGAAACAAGAAGG - Intergenic
1047010817 8:120670700-120670722 TCCTCTTTGAAGTCAAAAGGAGG + Intronic
1047068801 8:121318664-121318686 ACTTATTGTAAGACAAAGGGTGG - Intergenic
1047205393 8:122799108-122799130 CCTTCATGTAAGTGTAAAGGAGG - Intronic
1048394855 8:134004189-134004211 ACTTATTGAATGTCAAAAGGAGG - Intergenic
1048411029 8:134172829-134172851 ACTTATTGGAAGTTAGAAGGAGG - Intergenic
1048779750 8:137988105-137988127 TCTTCTTTCAAGTCTAAAGGAGG - Intergenic
1051167305 9:14277827-14277849 ACTTTTTGTGAGAAAAAAGGAGG - Intronic
1052439627 9:28478510-28478532 AATTCTTGTTACTCAAAATGTGG - Intronic
1055015559 9:71614086-71614108 TCTTCTTGGAAGGAAAAAGGTGG - Intergenic
1056226701 9:84502704-84502726 ACTTTTTCTAAGTCAAGGGGTGG - Intergenic
1056471482 9:86908749-86908771 AGTTCTTATAAGTGAAAAAGGGG - Intergenic
1056698966 9:88886655-88886677 GCTTCTTGTAAGCCAAACTGAGG + Intergenic
1060174709 9:121488934-121488956 ACATCTTGAAAGTGATAAGGAGG + Intergenic
1186013491 X:5164788-5164810 AATTTTTGAAAGTTAAAAGGAGG - Intergenic
1187100713 X:16188333-16188355 AATTCTTGTCCCTCAAAAGGGGG - Intergenic
1187486700 X:19711032-19711054 TCTTCTTGTCTGTAAAAAGGGGG - Intronic
1190447811 X:50547119-50547141 ACTCCTTGGAAGTAATAAGGCGG + Intergenic
1191102330 X:56744978-56745000 GCTTCCTTTAAGTGAAAAGGAGG - Intergenic
1194035760 X:88869355-88869377 ACTTCTTGGAAGTTAAAGAGTGG + Intergenic
1195030568 X:100923500-100923522 ATTTCTCATAAGTCAAAGGGTGG + Intronic
1197311554 X:124911555-124911577 ACTTCTGGTAGGTTAAAAAGTGG + Intronic
1197638084 X:128939082-128939104 CCTCCTTGTAAATCACAAGGTGG + Intergenic
1198003008 X:132459477-132459499 ACTTGGTGTAAATCAAAAGCTGG - Intronic
1198117478 X:133558192-133558214 CCTTGTTGTTAGTCAAAAGGGGG - Intronic
1201453747 Y:14145529-14145551 ACCTCCTCTAAGTCAAAAGCAGG - Intergenic
1202167340 Y:22003882-22003904 ACTGCTTGTAAGACAAGAAGAGG - Intergenic
1202224020 Y:22582487-22582509 ACTGCTTGTAAGACAAGAAGAGG + Intergenic
1202302447 Y:23431397-23431419 ATTTCTTGTAGGTAAAAAAGAGG - Intergenic
1202319095 Y:23613174-23613196 ACTGCTTGTAAGACAAGAAGAGG - Intergenic
1202551674 Y:26056883-26056905 ACTGCTTGTAAGACAAGAAGAGG + Intergenic
1202568364 Y:26239197-26239219 ATTTCTTGTAGGTAAAAAAGAGG + Intergenic