ID: 1174036382

View in Genome Browser
Species Human (GRCh38)
Location 20:47671009-47671031
Sequence GCCTGTGCCCTGAAAATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 234}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174036382_1174036387 28 Left 1174036382 20:47671009-47671031 CCACACATTTTCAGGGCACAGGC 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1174036387 20:47671060-47671082 CCATTCTTCCTGTTTGATGGTGG 0: 1
1: 0
2: 1
3: 17
4: 214
1174036382_1174036383 3 Left 1174036382 20:47671009-47671031 CCACACATTTTCAGGGCACAGGC 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1174036383 20:47671035-47671057 TTCTTGTTTTAAAGTCATGCAGG 0: 1
1: 0
2: 1
3: 18
4: 331
1174036382_1174036385 25 Left 1174036382 20:47671009-47671031 CCACACATTTTCAGGGCACAGGC 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1174036385 20:47671057-47671079 GGACCATTCTTCCTGTTTGATGG 0: 1
1: 0
2: 3
3: 11
4: 145
1174036382_1174036384 4 Left 1174036382 20:47671009-47671031 CCACACATTTTCAGGGCACAGGC 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1174036384 20:47671036-47671058 TCTTGTTTTAAAGTCATGCAGGG 0: 1
1: 0
2: 2
3: 11
4: 258
1174036382_1174036388 29 Left 1174036382 20:47671009-47671031 CCACACATTTTCAGGGCACAGGC 0: 1
1: 0
2: 2
3: 23
4: 234
Right 1174036388 20:47671061-47671083 CATTCTTCCTGTTTGATGGTGGG 0: 1
1: 0
2: 2
3: 13
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174036382 Original CRISPR GCCTGTGCCCTGAAAATGTG TGG (reversed) Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
904342230 1:29844082-29844104 GCTTGTGTCCTGACACTGTGAGG - Intergenic
905413678 1:37790184-37790206 GCCTTAGCCCTGCAATTGTGTGG + Intergenic
906149171 1:43577700-43577722 GCCTGGGCCCTGGGAAGGTGGGG + Intronic
906472688 1:46144373-46144395 TCCTGGGCCCTGCAAATGTTAGG - Intronic
908008316 1:59749378-59749400 GACTGAGCCCTGAAGCTGTGGGG + Intronic
910599030 1:89010659-89010681 GCCTCTGCCCTCAAAGTGTTAGG + Intronic
911799096 1:102110803-102110825 GCCTCTGCCCTAGAGATGTGTGG - Intergenic
913208537 1:116564156-116564178 GCCTGTGCCCTAAAGATACGTGG - Intronic
913966782 1:143383335-143383357 CCCTCTGCCCTGAACATGCGTGG - Intergenic
914061159 1:144208942-144208964 CCCTCTGCCCTGAACATGCGTGG - Intergenic
914117991 1:144757427-144757449 CCCTCTGCCCTGAACATGCGTGG + Intergenic
914902984 1:151721723-151721745 GCCTGTTCCCTGATAAAGTGGGG + Intronic
915058505 1:153159277-153159299 GCCTCTGCCCTGGAGATGTGTGG - Intergenic
916942420 1:169689612-169689634 CCCTGTGCAGTGAAAATCTGAGG + Intronic
916996676 1:170308937-170308959 GCCTATTCCGTGAAAATCTGGGG - Intergenic
917681902 1:177375952-177375974 GCCTCTGCCCTGGAGATTTGTGG - Intergenic
917734938 1:177911647-177911669 GCCTGGGCCCAGGAAAAGTGAGG + Intergenic
919388791 1:196955179-196955201 GCCCCTGCCCTGAAGATGTGTGG - Intronic
920601422 1:207328856-207328878 GCCTGGGCCCTGAAAATGTTAGG - Intronic
921566476 1:216727639-216727661 GCCTGTGCCCTAGAAATGAAAGG - Intronic
924927319 1:248695759-248695781 CCATGGGCCCTGCAAATGTGAGG - Intergenic
1063647581 10:7900567-7900589 TCCTGTGCCCCTATAATGTGGGG + Intronic
1063670798 10:8098027-8098049 GCAGGGGCCCTGAGAATGTGGGG + Intergenic
1064145142 10:12821042-12821064 GCCTGTTTCCTGCAATTGTGGGG + Intronic
1069729359 10:70600985-70601007 CCATGTGCCCTGATAATCTGTGG - Intronic
1070679629 10:78439482-78439504 GCCTGGGCCCACAAAGTGTGGGG - Intergenic
1071895057 10:90057240-90057262 ACATGTTCCCTGAAAATCTGTGG + Intergenic
1072890145 10:99316384-99316406 GCCTCTGCCCTGACATTCTGTGG - Intergenic
1076760168 10:132600315-132600337 GCCCGTGCCCTAGAGATGTGTGG - Intronic
1077097028 11:803437-803459 GCCTGTGTCCTGCAGATGCGAGG - Exonic
1077344356 11:2039497-2039519 GCCTGTGCCCTGGGAACCTGGGG - Intergenic
1078061042 11:8044670-8044692 GACTGAGCCCTTAAACTGTGGGG - Intronic
1080049924 11:27849041-27849063 CCCTGATCCCTGAAAATCTGGGG - Intergenic
1080263277 11:30374074-30374096 GCATGTGCCCTGAAGCTCTGAGG - Intergenic
1080268207 11:30423309-30423331 GTCTGTGCATTGAAAATTTGTGG - Intronic
1083335622 11:61920073-61920095 GCCTGTGCCCTGTACTTGAGGGG - Intronic
1083632031 11:64100774-64100796 GTCTGTGCCCTGGATAAGTGGGG - Intronic
1085194411 11:74659650-74659672 GCCTGTGCCCTAGAGATCTGTGG - Intronic
1085198996 11:74690274-74690296 GCCTGGGCCCTGCAAGTGTGAGG + Intergenic
1086742927 11:90389976-90389998 ACCTGAGGCCTGAAAATGTAGGG - Intergenic
1086826182 11:91501827-91501849 CCCTGTTCAGTGAAAATGTGTGG - Intergenic
1087047276 11:93852458-93852480 GCGTCTTCCCTGGAAATGTGTGG + Intergenic
1088904950 11:114148232-114148254 TCCTGAGCCTTGAAAATATGAGG - Intronic
1090392921 11:126401208-126401230 ACTTGTCCCCTGAAAATGTGTGG + Intronic
1202827342 11_KI270721v1_random:94686-94708 GCCTGTGCCCTGGGAACCTGGGG - Intergenic
1091793339 12:3283840-3283862 GCCTGCGCCCTCAGAACGTGTGG + Exonic
1091935659 12:4432622-4432644 TCCTCTGCCCTGCAAATGTCAGG - Intronic
1092162871 12:6325631-6325653 GCCTCTGCCCTGAAGCTGGGAGG - Intronic
1092750446 12:11714267-11714289 ATCTGTGCCCAGAAAATGTGGGG - Intronic
1093461896 12:19414463-19414485 GCCTATTCCCTGAAAATCTTAGG - Intronic
1094076552 12:26482291-26482313 CCCATTGCTCTGAAAATGTGTGG - Intronic
1094543706 12:31384518-31384540 GCCTGTGCTATAAACATGTGGGG - Exonic
1094846615 12:34364158-34364180 CCCTGGGCCCTGCACATGTGTGG + Intergenic
1094848379 12:34371434-34371456 CCCTGGGCCCTGAACATGCGTGG + Intergenic
1095640951 12:44484108-44484130 GCCTCTGCCCTTGAAATCTGTGG - Intergenic
1095916798 12:47487855-47487877 GACTGTGCCCTTAACCTGTGAGG + Intergenic
1097411136 12:59253905-59253927 GCCTGTTCCCCCAACATGTGGGG - Intergenic
1099951348 12:89307984-89308006 GCCAGTGCTCTGAAGATGAGAGG + Intergenic
1101560649 12:105854539-105854561 ACCTGTGCCTAGAAAATGTCTGG - Intergenic
1104404413 12:128505712-128505734 GGCGTTGCCCTGCAAATGTGAGG + Intronic
1107077109 13:36334459-36334481 GGCTGTCCTGTGAAAATGTGTGG + Intronic
1107378941 13:39834814-39834836 GCCTGTTCTCTAAAAATCTGTGG + Intergenic
1108149156 13:47513187-47513209 GTCAGTGCCCTGAAAAGCTGGGG + Intergenic
1110793716 13:79613177-79613199 GCCCCTGCCCTAGAAATGTGTGG - Intergenic
1111441350 13:88285829-88285851 ACCTCTGCCAGGAAAATGTGGGG + Intergenic
1112575946 13:100637014-100637036 GCCTGTGACCTCTAAATCTGAGG + Intronic
1114217284 14:20666309-20666331 GCCTCTGCCCTAAAGATTTGTGG - Intergenic
1115609276 14:35035912-35035934 GCCTCTGCCCTGGAGATTTGTGG - Intergenic
1116067468 14:40002382-40002404 GGCTGTGCAATTAAAATGTGTGG - Intergenic
1116079794 14:40157161-40157183 GCCCCTGCCCTGAAGATTTGGGG - Intergenic
1116831824 14:49727874-49727896 GCCAGTGAGCTGAAAATGTCAGG + Intronic
1116918664 14:50549479-50549501 TCCTGTGCCCTGGAATGGTGGGG + Intronic
1118032037 14:61827244-61827266 GCCTGTTCCCTCAGAAGGTGGGG - Intergenic
1121014436 14:90539677-90539699 CCCTGTGTCCTGGAAAGGTGGGG + Exonic
1121948347 14:98145213-98145235 GGCCGTGCCAGGAAAATGTGTGG - Intergenic
1122759641 14:104013393-104013415 GCCTCTGCCATGAACATGTACGG - Intronic
1124425869 15:29562124-29562146 GCCTGTGCCCTTCAAAACTGTGG + Intronic
1126230913 15:46323060-46323082 GTGTCTGCCCTGACAATGTGAGG - Intergenic
1127613042 15:60655784-60655806 CCCTGTGCCCAGAATATGTGTGG - Intronic
1128707258 15:69845702-69845724 CCCTGTGCCCTGTGTATGTGTGG + Intergenic
1129232175 15:74202937-74202959 GCCTGAGCCCTGCAAGGGTGTGG + Intronic
1129466730 15:75728296-75728318 GGCTTTGCCCTGAAGGTGTGAGG + Intergenic
1130974995 15:88767317-88767339 TACTGTGCCCTTAACATGTGGGG - Intergenic
1131341753 15:91608879-91608901 GCCTGTGCCCTGCTCAGGTGTGG - Intergenic
1132068125 15:98750290-98750312 CCCTGTGCCCTGAGACTTTGTGG + Intronic
1132270554 15:100520320-100520342 CCCTGTGTCCTGCAAATGTTAGG + Intronic
1134691333 16:16192616-16192638 GCCTGTGGCCTGAACATTGGAGG + Intronic
1136669066 16:31839609-31839631 GCCTGGAGCCTGAGAATGTGAGG - Intergenic
1138045188 16:53715157-53715179 GGCTTTGCCCTGAAAATGGTTGG + Intronic
1139254926 16:65531552-65531574 CCCTGTGCTCTCAGAATGTGAGG + Intergenic
1148685229 17:49497104-49497126 GGCTGCCCCCTGAAAAGGTGGGG - Intronic
1149999559 17:61425287-61425309 GACTCTGTCCTGGAAATGTGAGG + Intergenic
1152877415 17:82794901-82794923 CCCTTCGCCCTGTAAATGTGTGG + Intronic
1153330048 18:3864181-3864203 GCTTGTGGACAGAAAATGTGAGG + Intronic
1153331323 18:3878538-3878560 CCCTGTGCCCTGAGGAGGTGGGG - Intronic
1159129121 18:64259963-64259985 TCCTCTTCCCTGGAAATGTGCGG - Intergenic
1164119608 19:22254414-22254436 GCCTGTGCCCTGCCCATGAGGGG - Intergenic
1167603364 19:50467170-50467192 ACCTGTGCCCTGAAGGAGTGGGG - Intronic
1202700566 1_KI270712v1_random:160830-160852 CCCTCTGCCCTGAACATGCGTGG - Intergenic
925291867 2:2753288-2753310 GCCCCTGCCCTAAAAATCTGTGG + Intergenic
926328956 2:11809375-11809397 GCCAGTGGACTGAAAATGAGAGG + Intronic
928825772 2:35419715-35419737 GCCTGAGCCCTGAGAATCTCTGG - Intergenic
929012549 2:37459690-37459712 ACCTGTCCCCTCAAAATGTCAGG + Intergenic
929925040 2:46200934-46200956 CCCTGTGCCCTGTAAATCTCAGG - Intergenic
930484765 2:51998358-51998380 GCCTGTGCCCTAGAGATTTGTGG + Intergenic
930616137 2:53596405-53596427 GCCTGTGCCTAGAACATGTCAGG + Intronic
930897668 2:56464344-56464366 GGCTGTGCACTGCAACTGTGGGG - Intergenic
931246741 2:60498442-60498464 GGGTGTGCCCTGAGAAGGTGGGG + Intronic
932376908 2:71244492-71244514 GCATGTGCCATAAAAATTTGAGG - Intergenic
932428373 2:71658159-71658181 GCCTCTGCCCTAGAAATCTGTGG - Intronic
934171493 2:89544303-89544325 CCCTCTGCCCTGAACATGCGTGG - Intergenic
934281801 2:91618621-91618643 CCCTCTGCCCTGAACATGCGTGG - Intergenic
936396867 2:112138256-112138278 GCCAGTGCCCCGCATATGTGCGG - Intergenic
939508228 2:143075258-143075280 GCCTCTGCCCTGGAGATTTGTGG + Intergenic
941022234 2:160421217-160421239 ACCTGTGCCCTGCTAGTGTGCGG + Intronic
941826665 2:169906117-169906139 GCCTGTGCACAGCCAATGTGGGG + Exonic
942456649 2:176142686-176142708 GCCTCTGCCCCCAACATGTGTGG + Intergenic
942585706 2:177474500-177474522 GCCTGTGCACTGGAAGAGTGGGG - Intronic
942713488 2:178864673-178864695 GCCTGTGGTCTGTAAATGTGTGG + Intronic
944026156 2:195170645-195170667 TCCTGTGCCATAAAAATGTATGG + Intergenic
944321918 2:198355994-198356016 GTCTCTGCCCAGAAAAAGTGTGG + Intronic
946064595 2:216975664-216975686 CCCTGTGCCATGGAAAAGTGGGG + Intergenic
947491222 2:230596024-230596046 GCCTGTGGCCTAAGAATGTAAGG - Intergenic
1168963120 20:1882180-1882202 GCAGGTGCCCAGCAAATGTGGGG - Intergenic
1170471977 20:16676832-16676854 GGCTGAGCCATGAAAATGTGGGG - Intergenic
1170505085 20:17017292-17017314 GCCTGTCCCCAGTGAATGTGAGG - Intergenic
1173180707 20:40804439-40804461 GCCTGAGCCCTGAGAAGTTGGGG + Intergenic
1174036382 20:47671009-47671031 GCCTGTGCCCTGAAAATGTGTGG - Intronic
1174158807 20:48535704-48535726 GCCTGGGACCTGGAAGTGTGAGG - Intergenic
1175133584 20:56807149-56807171 GCCTGTGCCCTGCAAGTGGGCGG - Intergenic
1177179280 21:17727313-17727335 CCTTTTGCCTTGAAAATGTGTGG + Intergenic
1181972501 22:26702639-26702661 GCATGTGCACTGACAATTTGAGG + Intergenic
1183705795 22:39474290-39474312 CCCTGTGACCTGAAAATGGCAGG + Intronic
1183843280 22:40518306-40518328 GCCTGAGCCCTTAACCTGTGGGG + Intronic
1184931072 22:47681870-47681892 GCCTGTGCCCTGACACTCTGCGG - Intergenic
950259552 3:11534423-11534445 GCCTGTGAGCAGAAGATGTGAGG - Intronic
950414148 3:12858783-12858805 GCCTGGTCCCAGAAACTGTGCGG + Intronic
953028274 3:39158176-39158198 GACTGAGCCCTGAAGCTGTGGGG - Intergenic
954412128 3:50375361-50375383 TCCTCTGCCCTGAGACTGTGAGG + Intronic
955876252 3:63492986-63493008 TCATGTGCCTTGAAAATGTGTGG + Intronic
959982893 3:112537468-112537490 GCTTATGCCTTCAAAATGTGAGG - Intronic
960052108 3:113248999-113249021 CTCTGTGCCCTGAGAAAGTGAGG + Intronic
961646781 3:128397046-128397068 GCCTCTGCCCTGGAAGTGTTTGG + Intronic
961727461 3:128942044-128942066 GACTGTGCCCTCAAACTTTGTGG - Intronic
963988842 3:151629762-151629784 GCCTGTGACATGAAAATCTCAGG + Intergenic
964431070 3:156606276-156606298 GCGTGTGCCCAGAAGCTGTGCGG + Intergenic
964509860 3:157438365-157438387 GCCTGGGCCCTGAAATAGTGCGG - Intronic
964790582 3:160450317-160450339 GGGTGTTCCCTGAGAATGTGTGG - Intronic
965680900 3:171250242-171250264 GCCTGTCCCATGAAAATTAGAGG - Intronic
965720087 3:171651851-171651873 GCATGTGCCCTGGAAAAGAGAGG - Intronic
965897512 3:173595323-173595345 GCTTCTGCCCTGGAGATGTGTGG - Intronic
966925664 3:184643071-184643093 GCCTGGGGCCTGAAAGTGTGGGG - Intronic
966970236 3:185038879-185038901 GGCTGTGCACTGAAAATCTTCGG - Intronic
967566494 3:190979499-190979521 GCCTGTGCCCTAGAGATGTGTGG + Intergenic
968655954 4:1778524-1778546 GGCTGGGCCCTGAGAATGCGTGG + Intergenic
969028269 4:4191585-4191607 CCCTCTGCCCTGAACATGCGTGG + Intronic
970461196 4:16276606-16276628 GCCTCTGCCCTAGAAATCTGTGG + Intergenic
976162388 4:82217207-82217229 GCCTCTGCCCTGAAGATCTGTGG + Intergenic
976222531 4:82769204-82769226 GCCACTGCCCTGAGATTGTGAGG + Intronic
977285595 4:95102374-95102396 GGCTGTGCCTGGAAAATGGGAGG + Intronic
978213230 4:106163101-106163123 GCCCCTGCCCTGGAAATATGTGG - Intronic
979183343 4:117757424-117757446 GCCTCTGCCCTGGAGATTTGTGG + Intergenic
979700088 4:123657229-123657251 GCCTCTGCCCTAGAGATGTGTGG - Intergenic
980091465 4:128447513-128447535 GCCTGGCAGCTGAAAATGTGAGG + Intergenic
981611518 4:146598245-146598267 GCCTGTGCCCTAGAGATCTGTGG - Intergenic
981933914 4:150218695-150218717 GCCTGTGGCCTGACCATGTGGGG + Intronic
982075931 4:151737321-151737343 GCCCCTGCCCTGGAGATGTGTGG + Intronic
982395377 4:154910167-154910189 CCCTAGGCCCTGAAAATGTTAGG - Intergenic
984704859 4:182840241-182840263 GGCTGTGTCCTGAAGATGTTTGG - Intergenic
985585687 5:732624-732646 GCCTGTTCCCTGAAATCCTGGGG + Intronic
985600121 5:824053-824075 GCCTGTTCCCTGAAATCCTGGGG + Intronic
986801300 5:11262832-11262854 GCCTGTGAATGGAAAATGTGTGG - Intronic
987159744 5:15129911-15129933 GCCTGTGATCTGAGAATGTTTGG + Intergenic
993597910 5:89882401-89882423 TCCTCTGCCCTGAAAATGTGGGG - Intergenic
995429040 5:112054301-112054323 GCCTCTGCCCTAAAGATGTGTGG + Intergenic
995453320 5:112326393-112326415 GCCTCTGCCATGAAACTGGGAGG - Intronic
995882674 5:116860428-116860450 GGCTGTGCCCTGTAAAAGTTTGG + Intergenic
999376875 5:151092906-151092928 GCCTGTGGCCTCAAAGTTTGAGG - Intronic
999954550 5:156686352-156686374 GCATGTACCCAGAAAATGTCAGG + Intronic
1003173364 6:3737374-3737396 GCCTGGGCCATGAGCATGTGAGG - Intronic
1006171233 6:32094533-32094555 TCATGTGCCCCCAAAATGTGGGG - Intronic
1006341256 6:33448388-33448410 GCCGGTACCCTGAAAACTTGGGG + Intronic
1006630119 6:35424858-35424880 GCCTGAGCTCTGACAGTGTGGGG + Intronic
1009742126 6:67758906-67758928 GCCTGGGGCTTGGAAATGTGAGG - Intergenic
1011104282 6:83761830-83761852 GCCTTTGCCCTGGAAAAATGGGG - Intergenic
1011624285 6:89270769-89270791 CCAGGGGCCCTGAAAATGTGTGG - Intronic
1012146701 6:95693243-95693265 GACTGTCCCCTGCAAAAGTGTGG + Intergenic
1012510015 6:99992140-99992162 CCCTGTGCCCTGAAGATGCCGGG - Intronic
1013087643 6:106870066-106870088 GCCTGAGAGCTGAAAATGTTTGG + Intergenic
1013435417 6:110100447-110100469 GCTTGTTCCTTGAAAATGTTTGG - Exonic
1013767994 6:113595981-113596003 CCCTGGGCCCTGCAAATGTTAGG + Intergenic
1013962811 6:115921045-115921067 GCTTGTGACTTAAAAATGTGAGG - Intergenic
1016974579 6:149794721-149794743 GCCTTTGCCCTGATCCTGTGTGG + Intronic
1017049936 6:150380934-150380956 GCCTATGCTCTGAAAAAGAGTGG + Intronic
1017654523 6:156614597-156614619 GCCTCTGCCCTAGAAATCTGTGG - Intergenic
1018239100 6:161754609-161754631 GCCTGTGACCTGACCATGGGAGG - Intronic
1018502054 6:164421950-164421972 GTCTGTGCTCTGGAGATGTGTGG + Intergenic
1019750063 7:2723671-2723693 GCCTCTGCCCTGAAGCTGTGGGG - Intronic
1021762195 7:23913022-23913044 GCCTCTGCCCTAGAAATCTGTGG + Intergenic
1022269569 7:28793164-28793186 GCCTGAGACCTCAAAGTGTGGGG - Intronic
1024183825 7:46927264-46927286 GCCCCTGCCCTGAAAGTATGTGG - Intergenic
1024283711 7:47739372-47739394 GCCTGTTCCCTGAAACTTTGAGG - Intronic
1024445307 7:49470737-49470759 GACTGAGCCCTTAACATGTGGGG + Intergenic
1024472361 7:49776277-49776299 ACCTCTGCCCTGAAAAAGAGAGG - Intronic
1024656454 7:51454787-51454809 GGCTGAGCCCTGAAGTTGTGGGG + Intergenic
1025750659 7:64291115-64291137 ACCTGAACCCTGAAAATGTGTGG - Intergenic
1030716737 7:112816290-112816312 GCTTGTGACCAGAAAAGGTGAGG - Intergenic
1032389863 7:131548878-131548900 GCCTGTGCTCTGTAAATGCAAGG - Intronic
1032598379 7:133266191-133266213 GCCTTTGCTGTGTAAATGTGTGG + Intronic
1034470113 7:151250354-151250376 GCCTGGGCCCTGACACGGTGGGG + Intronic
1037900600 8:22686198-22686220 GCCGGTGACCTAAAATTGTGTGG + Intergenic
1038655422 8:29446487-29446509 GCCTGTGCTCAGAATAAGTGTGG + Intergenic
1038861784 8:31395957-31395979 GCCTAGGCCCTGCAAATGTTAGG - Intergenic
1043001117 8:74760563-74760585 CCCTGTGCCCAGAAAATAAGTGG + Intronic
1043257306 8:78151965-78151987 GCCTGTGCCATAAAAATGCTTGG + Intergenic
1043917134 8:85936182-85936204 GCCTGTCAAATGAAAATGTGAGG + Intergenic
1045707933 8:104948124-104948146 GCCTGTGTCACTAAAATGTGTGG + Intronic
1046211962 8:111087738-111087760 GCCTCTGCCCTTAATGTGTGTGG - Intergenic
1046359377 8:113130934-113130956 GCCTCTGCCCTAGAAATCTGTGG + Intronic
1047535003 8:125711746-125711768 GCCTCTGCCCTAGAAATTTGTGG + Intergenic
1048205751 8:132414031-132414053 GCCTGAGCCCTGCAATTGAGAGG - Intronic
1049027924 8:140009526-140009548 GCCTTTGTCCTGAGAATCTGTGG - Intronic
1049211652 8:141389352-141389374 GGCTGAGCCGTGAAAAGGTGGGG - Intergenic
1049601177 8:143508350-143508372 GCCTGTGCCCTGCACAGGGGAGG + Intronic
1049612349 8:143561496-143561518 CCCTGTGCCCTGAGAACATGAGG - Intronic
1050264126 9:3872057-3872079 GCCTCTGCCCTGGAGATTTGTGG - Intronic
1050909877 9:11055321-11055343 GCCCCTGTCCTAAAAATGTGTGG + Intergenic
1052522139 9:29562312-29562334 GCCTCTGCCCTAGAGATGTGTGG + Intergenic
1053289852 9:36872767-36872789 GCCTGTGCCCTCATAGGGTGGGG - Intronic
1053574432 9:39344585-39344607 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1053838996 9:42172833-42172855 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1054117459 9:61179214-61179236 GCCCCTGCCCTGGAGATGTGTGG + Intergenic
1054590296 9:67003352-67003374 GCCCCTGCCCTGGAGATGTGTGG - Intergenic
1055564068 9:77550145-77550167 GTCTGTGCCCTGCAAATGTACGG + Intronic
1057298906 9:93865326-93865348 GCCTGTGGCCTGGAGAGGTGGGG - Intergenic
1058994926 9:110290429-110290451 GCCTGTGCTCTGGAATGGTGGGG + Intergenic
1059857558 9:118416774-118416796 GCCTGGGCCCAGAAATTGTATGG + Intergenic
1060723988 9:125995432-125995454 GCCTGTTCCCAGAAAATGCCAGG - Intergenic
1060820634 9:126659488-126659510 GCCCCTGGCCTGAGAATGTGTGG - Intronic
1062038697 9:134394417-134394439 GCCTGTGCCCTGGGAGTTTGAGG + Intronic
1203427046 Un_GL000195v1:50900-50922 GACTGAGCCCTGAATTTGTGGGG + Intergenic
1186481215 X:9897035-9897057 GCCTCTGACATGGAAATGTGTGG + Intronic
1186485917 X:9934148-9934170 ACCTGTGCTGTGTAAATGTGGGG + Intronic
1186657458 X:11630427-11630449 GCCTGGGCCCTATAAATCTGTGG + Intronic
1189252282 X:39610702-39610724 TCCTCTTCCCTGAAAATCTGCGG + Intergenic
1189578691 X:42382949-42382971 GCCTGTACCCTGGAAATGCTGGG + Intergenic
1190772377 X:53526219-53526241 GCCTCTGCCCTAAAGATCTGTGG + Intergenic
1190828544 X:54040868-54040890 TCCTTTGCCCTGAAAATAAGTGG - Intronic
1190829698 X:54048650-54048672 GCTGCTGCCCTGGAAATGTGTGG + Intronic
1191247051 X:58236173-58236195 GCCTCTACCATTAAAATGTGAGG - Intergenic
1192810761 X:74545338-74545360 GACTGTGCCCTTAACCTGTGGGG + Intergenic
1194554293 X:95338109-95338131 GCCTCTGCCCTAGAGATGTGTGG - Intergenic
1195126817 X:101816050-101816072 GCCTGTGCCCTAGAGATTTGTGG - Intergenic
1195862917 X:109400305-109400327 CCCTGTGCCTTGAGAATGAGAGG + Intronic
1196525874 X:116726764-116726786 GCCCCTGCCCTAAAAATATGTGG + Intergenic
1196932706 X:120696859-120696881 CTCAGTGCCCTGAAAGTGTGGGG - Intergenic
1198678490 X:139156288-139156310 GCCTGTCCCCATAGAATGTGAGG - Intronic
1199157842 X:144571497-144571519 GCCTCTGCCCTAGAAATGTGTGG + Intergenic
1199571380 X:149270300-149270322 GCCTGTGCCTGGGACATGTGGGG - Intergenic