ID: 1174037904

View in Genome Browser
Species Human (GRCh38)
Location 20:47679308-47679330
Sequence TGACCAAGGAGGCCCGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174037900_1174037904 -3 Left 1174037900 20:47679288-47679310 CCCTTTAGTTCTTTGCTCTATGA 0: 1
1: 0
2: 1
3: 21
4: 316
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037896_1174037904 8 Left 1174037896 20:47679277-47679299 CCGTCCCTCACCCCTTTAGTTCT 0: 1
1: 0
2: 7
3: 51
4: 789
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037899_1174037904 -2 Left 1174037899 20:47679287-47679309 CCCCTTTAGTTCTTTGCTCTATG No data
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037898_1174037904 3 Left 1174037898 20:47679282-47679304 CCTCACCCCTTTAGTTCTTTGCT 0: 1
1: 0
2: 2
3: 29
4: 299
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037893_1174037904 27 Left 1174037893 20:47679258-47679280 CCCTGGAGATCAGGGGCCACCGT 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037895_1174037904 11 Left 1174037895 20:47679274-47679296 CCACCGTCCCTCACCCCTTTAGT 0: 1
1: 0
2: 2
3: 21
4: 363
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037894_1174037904 26 Left 1174037894 20:47679259-47679281 CCTGGAGATCAGGGGCCACCGTC 0: 1
1: 0
2: 3
3: 14
4: 117
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037897_1174037904 4 Left 1174037897 20:47679281-47679303 CCCTCACCCCTTTAGTTCTTTGC 0: 1
1: 0
2: 2
3: 26
4: 224
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97
1174037901_1174037904 -4 Left 1174037901 20:47679289-47679311 CCTTTAGTTCTTTGCTCTATGAC 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174037904 Original CRISPR TGACCAAGGAGGCCCGTGAC AGG Intronic
900208299 1:1440884-1440906 GGACCAAGGAGGCCTGACACTGG - Exonic
901615238 1:10534284-10534306 TGACCCTGGGGGCCAGTGACTGG + Intronic
906943645 1:50277253-50277275 TGAACAAGGATGCCCTTGGCTGG + Intergenic
908523961 1:64969760-64969782 TGACCAAGGATGCCACCGACTGG + Intergenic
910738193 1:90485706-90485728 TGACCATGGAGGCCTATAACAGG + Intergenic
911569195 1:99502204-99502226 TGAACAAGGAGGCTGGTGTCTGG - Intergenic
915370758 1:155348141-155348163 GGGACAAGAAGGCCCGTGACAGG - Intronic
916872185 1:168927599-168927621 TGACCCAGGAGTCCCATTACTGG - Intergenic
919037025 1:192325471-192325493 TGACCCAGCAGTCCCATGACTGG - Intronic
923535428 1:234846869-234846891 TGACCCAGGAGTCCCATTACTGG - Intergenic
1071942264 10:90603003-90603025 TGACAATGGAGGACCATGACTGG + Intergenic
1077072240 11:680645-680667 TCACCAAGGACGCCCTTGTCAGG + Intronic
1078022536 11:7667758-7667780 TCACCAAGGACCCCAGTGACAGG - Exonic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1087026430 11:93654315-93654337 TGTCGAAGGAGGGACGTGACTGG + Intergenic
1091585531 12:1814104-1814126 TGACCACGGAGGCCAAGGACAGG - Intronic
1096257837 12:50073736-50073758 TGAGGAAGGAGGCCAGTGAGGGG + Intronic
1098447807 12:70585446-70585468 TGTCCAAGGAGGGAGGTGACTGG + Intronic
1098938828 12:76511258-76511280 TGACCCAGCAGTCCCGTTACTGG - Intronic
1099686480 12:85895893-85895915 TGACCAAGCAATCCCGTTACTGG - Intergenic
1104721204 12:131046073-131046095 TGACCAGGGAGGACGCTGACCGG - Intronic
1104956128 12:132466686-132466708 TGACCAGGGACACCTGTGACCGG + Intergenic
1106193960 13:27477350-27477372 TGCCCCTGGAGGCCGGTGACGGG - Intergenic
1111808421 13:93067122-93067144 TGAGCAAGGAGGCCGGTTGCTGG + Intergenic
1112458267 13:99581295-99581317 TGCCCAAAGAGGCACCTGACAGG - Intergenic
1113491976 13:110699365-110699387 TGACCATGGACGCCGGTGACAGG + Intronic
1115410520 14:33068888-33068910 TGAGCAAGGAGGACAGTGGCAGG + Intronic
1119177955 14:72583259-72583281 AGGCCAAGGAGTCCCATGACAGG - Intergenic
1130626052 15:85516609-85516631 GGACCAAGGAAGGCCGTGGCAGG - Intronic
1137823251 16:51465458-51465480 TGACCAAAGAGGCCCAGGATGGG - Intergenic
1140485316 16:75288809-75288831 GGACCAGGAAGGCCGGTGACAGG - Intergenic
1145785816 17:27593259-27593281 TGTGCAAAGAGGCCCATGACAGG - Intronic
1146501087 17:33364989-33365011 TGACCCTGAAGGCCCATGACTGG - Intronic
1152745489 17:82036858-82036880 TCACCAAGGAGGCCTTTGACAGG - Exonic
1157424937 18:47576843-47576865 AGACCAAGGAGGCTGGGGACCGG + Intergenic
1159955533 18:74516027-74516049 GCACAAAGGAGGCCCCTGACAGG - Intronic
1161125691 19:2556066-2556088 TGGACAAGGAGGCCCGAGGCAGG + Intronic
1161769292 19:6222619-6222641 TGACCAAGGAGCACCGGGAGCGG - Exonic
1165152755 19:33770626-33770648 CTACCAAGGAGGCCCATGCCTGG - Intronic
1165168541 19:33873741-33873763 TGGCCAAGGAGGGTAGTGACTGG + Intergenic
925439848 2:3875999-3876021 TGACCGAGGAAGGCCGTGAATGG - Intergenic
925698719 2:6611380-6611402 TGACCCAGGAATCCCGTTACTGG - Intergenic
935701083 2:105812554-105812576 TGACCAAGGAGGCCCAGCAGAGG - Intronic
938113942 2:128590837-128590859 TAACCAAGGAGGCCCGAGCCAGG - Intergenic
941391787 2:164923942-164923964 CAACCAAGGAGTCCCGTTACTGG + Intronic
942323169 2:174753669-174753691 TGATCAAGGAGTCCCGGGGCTGG - Exonic
946075150 2:217067784-217067806 TGACCCAGCAATCCCGTGACTGG + Intergenic
1170117035 20:12871666-12871688 GGACCAAGGACACCCGTGGCAGG + Intergenic
1172596477 20:36154357-36154379 AGAGCAAGGAGGCCCGGGGCTGG + Intronic
1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG + Intronic
1175367791 20:58467492-58467514 TGACCCAGGAGGCCCGGCGCAGG + Exonic
1178580802 21:33836525-33836547 TCAACAAGGAGGACCCTGACTGG + Exonic
1179102275 21:38364676-38364698 TGACCAAGCAGTCCCATTACTGG + Intergenic
1180091728 21:45536968-45536990 TGACCTGAGAGACCCGTGACTGG + Intronic
1183357328 22:37366746-37366768 TCACGAAGGAGGCCTGGGACTGG + Intergenic
1183452625 22:37905468-37905490 AGGCCAAGGAGGCCCCTGCCTGG - Intergenic
1184206136 22:43004792-43004814 CGCCCAGGGAGGCCTGTGACGGG - Intronic
1185367660 22:50444260-50444282 TGACCAGGGTGGGCCGTGGCCGG - Exonic
953074572 3:39556827-39556849 TGACCAAGGAATCCCATTACTGG + Intergenic
954708451 3:52493516-52493538 TCACCAAGGTGGCCCTTGAATGG + Intergenic
955331860 3:58053971-58053993 TGTCCTAGAAGGCCCGTGGCAGG + Intronic
959427642 3:106211818-106211840 TGAAAAAGGAAGCCTGTGACTGG + Intergenic
963850324 3:150204546-150204568 TGACCTAGGAGGCTTGTGATGGG + Intergenic
968642679 4:1722191-1722213 TGACTATGGAGGCCCGGGAGGGG - Intronic
968762264 4:2448849-2448871 TGGCCAAGGAGGGCAGTGAGAGG + Intronic
969333070 4:6491225-6491247 TGATCAAGGAGGCCAGTAAGTGG + Intronic
969411546 4:7031708-7031730 TGACTAACCAAGCCCGTGACCGG - Exonic
969447205 4:7252198-7252220 TCGCCAAGGAGGCCCGAGGCAGG + Intronic
969971705 4:11054653-11054675 AGACCCAGGAGGCCCATGGCCGG + Intergenic
971302352 4:25452085-25452107 TGACCAAGGAAGTCCGTTTCTGG + Intergenic
971355489 4:25891159-25891181 TGCCCAAGGAGCCCCGTTTCTGG + Intronic
975192206 4:71478238-71478260 TGACCCAGCAATCCCGTGACTGG + Intronic
975650756 4:76590316-76590338 TGACCAGGGAGGCCAGTTGCGGG + Intronic
975874353 4:78818277-78818299 TGACCCAGCAATCCCGTGACTGG - Intronic
981871157 4:149487444-149487466 GGACTAAGGTGGCACGTGACAGG - Intergenic
984061889 4:174999419-174999441 TGACCCAGCAGTCCCGTTACTGG - Intergenic
986168050 5:5292854-5292876 TGTCCAGGGAGGCCCTTGATCGG + Intronic
988688981 5:33553341-33553363 TGACCAAGCAGTCCCATTACTGG + Intronic
996174893 5:120344298-120344320 TGACCCAGCAGTCCCGTTACTGG + Intergenic
1003116297 6:3285915-3285937 TGTCCCAGGAGGACCGTGCCAGG + Intronic
1003568850 6:7242719-7242741 TGACCAAGGAGGTCCTTGAGGGG + Intronic
1013901393 6:115161175-115161197 TGACCCAGCAGTCCCGTTACTGG - Intergenic
1017027119 6:150191054-150191076 GGACCAAGGAGGCCAATGTCGGG - Intronic
1026968450 7:74454324-74454346 TGCCCGGGGAGGCACGTGACTGG + Intronic
1027185328 7:75967703-75967725 TTACCAAGGAGACCCGAGTCGGG + Intronic
1029728749 7:102425696-102425718 TGCACAAGGAGGCCCGGGCCAGG + Exonic
1031249724 7:119364219-119364241 TGACCCAGGAATCCCGTTACTGG - Intergenic
1038235333 8:25747229-25747251 TGACCCAGGAATCCCGTGACTGG - Intergenic
1042507456 8:69576061-69576083 TGAGCATGGAGGACCGTGACGGG - Exonic
1043554531 8:81415757-81415779 TGACCCAGGAAGCCCATTACTGG + Intergenic
1044516588 8:93146083-93146105 TCACCAAGGAGACCAGTGCCTGG + Intronic
1044545132 8:93450802-93450824 TGTCAAAGGAGGGCAGTGACTGG + Intergenic
1045269520 8:100649811-100649833 TCTCCAAGAAGGCCCGTGAGGGG + Intronic
1048796062 8:138151313-138151335 TGCCCAAGGAGACCCCTGCCAGG - Exonic
1049499799 8:142955748-142955770 TGACCCAGGAGGCCAGAGATGGG + Intergenic
1050196843 9:3093807-3093829 TGACCCAGGAATCCCGTTACTGG - Intergenic
1050541406 9:6673660-6673682 TGACCCATGAGGCCCATGAAGGG + Intergenic
1055399100 9:75904256-75904278 TGACAAAGGAAACCTGTGACTGG - Intronic
1061043405 9:128152157-128152179 TGACCAAGATGGCCAGTGAGTGG - Intronic
1061195609 9:129105658-129105680 TGTCCAAGGAGGCAGGAGACTGG + Intronic
1192312973 X:70031789-70031811 TGTCCAGGGAGGCCAGAGACAGG + Intronic
1198148915 X:133888437-133888459 TGACCAAGCAATCCCGTTACTGG - Intronic
1200099943 X:153685361-153685383 TGACCCGGGCGGCCAGTGACAGG - Intronic
1201368893 Y:13238524-13238546 TGTCCAAGGAGGCCAGTGCTTGG - Intergenic