ID: 1174039268

View in Genome Browser
Species Human (GRCh38)
Location 20:47687447-47687469
Sequence CTGGGGAAATGGCGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 486}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174039259_1174039268 -8 Left 1174039259 20:47687432-47687454 CCCCCTTCCCTTCTGCTGGGGAA 0: 1
1: 1
2: 7
3: 46
4: 366
Right 1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG 0: 1
1: 0
2: 1
3: 61
4: 486
1174039261_1174039268 -10 Left 1174039261 20:47687434-47687456 CCCTTCCCTTCTGCTGGGGAAAT 0: 1
1: 1
2: 8
3: 31
4: 279
Right 1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG 0: 1
1: 0
2: 1
3: 61
4: 486
1174039255_1174039268 -4 Left 1174039255 20:47687428-47687450 CCATCCCCCTTCCCTTCTGCTGG 0: 1
1: 0
2: 7
3: 101
4: 955
Right 1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG 0: 1
1: 0
2: 1
3: 61
4: 486
1174039260_1174039268 -9 Left 1174039260 20:47687433-47687455 CCCCTTCCCTTCTGCTGGGGAAA 0: 1
1: 0
2: 3
3: 26
4: 416
Right 1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG 0: 1
1: 0
2: 1
3: 61
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174039268 Original CRISPR CTGGGGAAATGGCGGGAAGA TGG Intronic
900143088 1:1146646-1146668 CTGGGCAGAGGGCGGGAAGCGGG + Intergenic
900597842 1:3490590-3490612 CTGGGGAAAAGGAGAAAAGAGGG + Intronic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
901031577 1:6310226-6310248 CGGGAGAAAAGGTGGGAAGAGGG + Intronic
901456528 1:9366223-9366245 CTGGGGCAGTTGCGGGGAGAAGG + Intronic
901673792 1:10871107-10871129 CTGGGGAAATGGCTGGGGGCGGG + Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
904340396 1:29830409-29830431 CTGGGGACATGGGGGCAGGATGG - Intergenic
904879310 1:33682937-33682959 CTGGGGAAAAGGTGGGGAGTGGG - Intronic
905201868 1:36321429-36321451 CTGGAGAAATGGCGGGCAGGAGG + Intronic
905251056 1:36648675-36648697 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
905875676 1:41430872-41430894 CTGGGGAAAAGGTGGGCAGTGGG + Intergenic
907320617 1:53599984-53600006 ATGGGGAAATGGAGGCACGAGGG - Intronic
907364466 1:53946828-53946850 TTGGGGAGAGAGCGGGAAGAAGG + Intronic
907494665 1:54835949-54835971 GTGGGGTAAGGGCAGGAAGATGG - Intronic
907907399 1:58795883-58795905 CTGGAGAAATGGGGGGCTGAGGG + Intergenic
909456178 1:75852032-75852054 CTGGGGAAACGGGGGTTAGAAGG - Intronic
910201046 1:84699015-84699037 GTGGGGAAATGGCAGGATGGAGG - Intergenic
910771432 1:90835972-90835994 CTCGGGAAATGGGTGGAATAGGG - Intergenic
911583236 1:99659509-99659531 CTGGGGAAATTTAGGGAAGCAGG + Intronic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
911754446 1:101536817-101536839 GTGTGGAAAGGGTGGGAAGACGG + Intergenic
912422483 1:109553852-109553874 CGGGGGAAAGGGTGGGAAGGTGG - Intronic
912446055 1:109737644-109737666 CCGGGGAAAAGGTAGGAAGAAGG - Exonic
912701916 1:111884400-111884422 CTGGGGAAATGTCAGTAACAAGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
912977774 1:114345865-114345887 CTGGGGAAAGGACAGGGAGAGGG + Intergenic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
915032938 1:152899749-152899771 CTGGGGAAATGGGGAGATGTTGG - Intergenic
915399484 1:155611898-155611920 CTGGGGAAGGGCAGGGAAGATGG - Intronic
915416597 1:155747478-155747500 CTGGGGAAGGGCAGGGAAGATGG - Intergenic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915626894 1:157119355-157119377 CTGGTGAAGTGGGGGAAAGAAGG + Intergenic
916891686 1:169117804-169117826 CTGGGGAGATGAAGGGAACAGGG + Intronic
919309245 1:195886215-195886237 CTGGGCAAATGACAGGGAGAGGG + Intergenic
919880536 1:201897908-201897930 GTGGGAAAATGGCAGAAAGATGG - Exonic
920067635 1:203280298-203280320 CTGAGGAAATGGCACGTAGAAGG - Intergenic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
920940459 1:210477348-210477370 CTAGGGAAACAGTGGGAAGAAGG - Intronic
922518864 1:226228649-226228671 CTGGGGGAATGGCAGGGACAAGG - Intergenic
922567433 1:226610140-226610162 CTGAGGAAATGGCAGGAGGCAGG - Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923552780 1:234977511-234977533 CTGAGGACATGGGGTGAAGATGG - Intergenic
923573437 1:235137080-235137102 TTGGGGATATGCCAGGAAGAAGG - Intronic
923747833 1:236719090-236719112 ATGGTGAAAGGGAGGGAAGAAGG - Intronic
923802939 1:237228120-237228142 GTGGGGAAAGGGTGGGAAGAGGG - Intronic
924482670 1:244451459-244451481 GTGGAGAAATGGCGGGAGGTCGG - Intronic
924709161 1:246519640-246519662 CTAGGGGAATGGGGAGAAGAAGG + Intergenic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1063978699 10:11436874-11436896 CTGGGAAAGTGGCAGGATGAAGG + Intergenic
1064556713 10:16553845-16553867 TTGGGGAAAGGGTGGGAAGTGGG - Intergenic
1065972684 10:30817906-30817928 CTGGGGTATTGGAGGGAAGCTGG + Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067757722 10:49017680-49017702 AAAAGGAAATGGCGGGAAGAGGG - Exonic
1068297884 10:55098565-55098587 CTTGGCAAATAGAGGGAAGATGG - Intronic
1069541311 10:69296181-69296203 TTGGGGAATGGGAGGGAAGAGGG - Intronic
1069773584 10:70914313-70914335 CTGGGGCAATGGCAGGCAGTGGG + Intergenic
1069893083 10:71664115-71664137 CTGGGGAGATGCCTGGAGGAGGG - Intronic
1069954812 10:72043451-72043473 CTGGGGAAAGGAGGAGAAGAGGG + Intergenic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1071054203 10:81490480-81490502 TGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1071570554 10:86694422-86694444 CTAGGGAAATCTGGGGAAGAGGG + Intronic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072764213 10:98082842-98082864 CAGGGGACATGGGGGGAAGCTGG + Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1074015473 10:109529902-109529924 CTGGGGAAGTGCAGGGAACAGGG + Intergenic
1074153988 10:110782643-110782665 CTGGGGAGGTGGCGGGGAGAAGG - Intronic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1075474031 10:122717816-122717838 CTGGGGTAATGGAGGTAAGGCGG - Intergenic
1075576359 10:123580557-123580579 CTGGGGCAATGGGAGGAAGTTGG - Intergenic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076364639 10:129914152-129914174 CAGGGGACATGACGGGCAGAGGG + Intronic
1076664994 10:132082375-132082397 TCGGGGAAAGGGTGGGAAGAGGG - Intergenic
1077959078 11:7053932-7053954 GTGGGGGAATGAGGGGAAGAGGG - Intronic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078646012 11:13141951-13141973 CGGGGGAAATGGAAGGAAGCCGG + Intergenic
1080539943 11:33256491-33256513 CTAGGGAAAAGGAGGAAAGATGG + Intergenic
1080982063 11:37419862-37419884 CTGTGGAAATGGCAGCAACAAGG + Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081539493 11:44020774-44020796 CAGGGGAAATGGTGGGAGGGGGG - Intergenic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1083276042 11:61597703-61597725 ATGGGGAAATGGGGGGCAGAGGG - Intergenic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1087481460 11:98706445-98706467 CTGGGGACACGGCGAGAAGGTGG + Intergenic
1087549220 11:99626120-99626142 CTGTAGAAATTGCAGGAAGAAGG + Intronic
1087701531 11:101441315-101441337 TTGGGGAAATGGGGGGCAGATGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088217640 11:107530563-107530585 ATGGGGAAATGGGGGAGAGAGGG - Intronic
1089338730 11:117743496-117743518 TTGGGGAACTGGTGGGCAGATGG - Intronic
1089391367 11:118104279-118104301 CTGGGGAAATGTCTGAGAGAGGG - Intronic
1090057513 11:123436271-123436293 CTGGGGAAATGGGATGGAGAGGG - Intergenic
1090611711 11:128477129-128477151 CTGGTGAAATGGCAGGGAGATGG + Intronic
1090736939 11:129618365-129618387 CTAGAGAAAGGGCGGCAAGACGG + Intergenic
1091388755 12:112286-112308 GTGGGGAAGTGGGGGGAAGGGGG + Intronic
1091786524 12:3246360-3246382 CTGGGAAAAGGTGGGGAAGAGGG - Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092949961 12:13492626-13492648 CTTTGGAAATGGCAGGAAGAAGG + Intergenic
1093030414 12:14283515-14283537 CTGGAGAAATGAAGGTAAGAGGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095567586 12:43644481-43644503 CTGGGGAAACCTTGGGAAGAGGG - Intergenic
1096546808 12:52345698-52345720 GTGGGGGAATGGCTTGAAGAAGG + Intergenic
1097023262 12:56035389-56035411 CTTGGGAAATGGTGGGGACAGGG - Exonic
1098382234 12:69881401-69881423 CTGGGGAAGTGGTGGGATGGGGG - Intronic
1098680524 12:73348158-73348180 CTAGGGTAATGGTGGGGAGAGGG + Intergenic
1098952864 12:76659780-76659802 AGGGGGAAAGGGTGGGAAGAGGG + Intergenic
1099014754 12:77331000-77331022 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1099550535 12:84038270-84038292 CTGGGGAAAGGGCAAGAAGTAGG + Intergenic
1099751462 12:86779492-86779514 CTGGGGAAGTGGAGGTGAGAGGG + Intronic
1100280313 12:93112304-93112326 CTGGGGAAAGTGCTGGGAGACGG - Intergenic
1100421830 12:94442352-94442374 CTGGGGACCTGGGGGGAAGGAGG + Intronic
1100759817 12:97794907-97794929 CTGGGCAAAAGGCAGGGAGAGGG - Intergenic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102741791 12:115213927-115213949 CTGGGGATATGGCAGGAACTGGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103483133 12:121264157-121264179 CTGGGGATGTGACGGGAAGGAGG - Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1104160688 12:126177336-126177358 CAGGGAAAAGGGTGGGAAGAGGG + Intergenic
1104378800 12:128288855-128288877 CTGGGGAAATCAAGGGAAGGAGG - Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105498417 13:20950616-20950638 CTGGGGAAAGGGCGGGGAAGAGG - Intergenic
1105759760 13:23503216-23503238 CTGGGGCAAGGGCAGGAACATGG - Intergenic
1106232359 13:27830398-27830420 CTGGGGTAAGGGTGGGAAGGGGG + Intergenic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106459654 13:29957800-29957822 TTGGGGAAATAACGGGAAGAGGG + Intergenic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107896624 13:44971257-44971279 ATGAGGAAATGGGGTGAAGATGG - Intronic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110205218 13:72904029-72904051 GTTGGGAAATGACGGGAAAATGG + Intronic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1110931312 13:81221861-81221883 ATGGGGAAATGTCGGTCAGAGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112412919 13:99179340-99179362 CTGGGCAAACGGAGGGAAGCAGG - Intergenic
1113114679 13:106862706-106862728 AAGGGGAAAGGGCGGGAAGGGGG + Intergenic
1113313632 13:109156668-109156690 CTGGGGAAAGGCCAGGAAGCAGG - Intronic
1113447703 13:110382385-110382407 CTGGGGAAGTGGGCGGAAGACGG - Intronic
1114134370 14:19830211-19830233 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1115350180 14:32385555-32385577 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1116007364 14:39309199-39309221 CAGGAGAAAGGGCGGAAAGAAGG - Intronic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117473152 14:56067086-56067108 CTGGGGAAACTGGGGGAATAGGG + Intergenic
1117704670 14:58452124-58452146 GTGGGGAAAGGGTGGGAAGCGGG + Intronic
1118420887 14:65602123-65602145 CGGGGGAAATGGTGGGAAGGAGG - Intronic
1119203024 14:72772432-72772454 GTAGGGAAATTGCAGGAAGAAGG + Intronic
1120562763 14:86017408-86017430 CTGGGGAAATAACCAGAAGATGG + Intergenic
1120901912 14:89582766-89582788 CAGGGGAGATGGCTGGGAGAAGG - Intronic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121050482 14:90816429-90816451 CTGGGGAAGGGGCGGGGAGGCGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121816336 14:96931924-96931946 CTGCGGAAATGCAGGCAAGATGG + Intergenic
1122356474 14:101125916-101125938 CTGGGCAGACGGCGGGGAGATGG - Intergenic
1122599585 14:102914654-102914676 CTGGGCACAGGGCAGGAAGAGGG + Intergenic
1122825965 14:104370605-104370627 CTGTGGAAAGAGCGTGAAGACGG - Intergenic
1123577427 15:21685802-21685824 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123614050 15:22128272-22128294 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123938636 15:25206062-25206084 CTGGTGAGATAGCTGGAAGATGG - Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124849700 15:33324321-33324343 CTGGGGAAATGGGGGAAGGAAGG + Intronic
1124948835 15:34297045-34297067 CTGGGTTAATGGCAGGATGAGGG - Intronic
1125399790 15:39288943-39288965 CGAGGGAAAGGGTGGGAAGAGGG + Intergenic
1125983242 15:44023229-44023251 CTGGGGAAATTGAGGGGAAATGG - Intronic
1127629123 15:60809924-60809946 CTGGGGAAATAGCTTCAAGAAGG - Intronic
1128145943 15:65332650-65332672 CGGGGGAAAGGGTGGGAAGTGGG - Intronic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1129686387 15:77688445-77688467 ATGGGGAGAGGGAGGGAAGAGGG + Intronic
1129889976 15:79065531-79065553 CTGGGGCATTGGCAGGAGGAAGG + Intronic
1130064710 15:80594128-80594150 CTGGGGGAATGCTGGGAAAATGG + Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1202986296 15_KI270727v1_random:420047-420069 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132772281 16:1570474-1570496 CTGAGCAAATGGAGGGTAGATGG - Intronic
1133025633 16:2987940-2987962 CTGGGGAGAGGGCGGGAACCAGG - Intergenic
1134353422 16:13459323-13459345 CTGGTGACATGGGGGGAGGAGGG + Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1134855834 16:17518296-17518318 TTGGGGAAAGGGTGGGAAGAGGG - Intergenic
1135215729 16:20565811-20565833 TGGGGGAAATGACGGGAAGGAGG - Intronic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135620461 16:23950962-23950984 CCAGGGACAAGGCGGGAAGAGGG - Intronic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136239068 16:28933127-28933149 CTGGGGAGATGCCGGGAAGCGGG + Intronic
1136376897 16:29871229-29871251 TTGGGGAGATGGCAGGAAGGGGG + Exonic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138695586 16:58810011-58810033 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1139258068 16:65562588-65562610 CTGGGGAAATGGCTGGGTGATGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1143435001 17:6917469-6917491 AGGGGGAAAGGGCGGGAAGAGGG + Intronic
1143565285 17:7717194-7717216 GCGGGGAAAGGGAGGGAAGACGG - Intergenic
1143773721 17:9184311-9184333 CAGGGGAAATGGCGAAGAGAAGG + Intronic
1143871150 17:9958096-9958118 GTGGGGAAATGGGGGGTAGTGGG - Intronic
1144124957 17:12194631-12194653 ATGGGGAAAGGGTGGGAAGCAGG + Intergenic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144575974 17:16429727-16429749 CTGGGGAGATGGCAGGAGGGTGG + Intronic
1144740528 17:17579847-17579869 CTCCGCAAATGGCGGGAAGAAGG + Intronic
1145752909 17:27367937-27367959 CTTGGCACATGACGGGAAGAGGG - Intergenic
1146910668 17:36646485-36646507 CTGGGGAAGAGGGTGGAAGAGGG + Intergenic
1147572485 17:41579949-41579971 GTGGGGAAATCCCGGGAGGAGGG + Intergenic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1147893022 17:43730642-43730664 ATGGGGAAACGGGGAGAAGATGG + Intergenic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148821423 17:50361943-50361965 CTTGGGAAAGGGAGGGAGGATGG - Intronic
1149022644 17:51987370-51987392 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1149124244 17:53208623-53208645 AGGGGGAAAGGGCGGGAAGAGGG + Intergenic
1149413496 17:56433673-56433695 AAGGGGAAAGGGCGGGAAGGGGG + Intronic
1151240539 17:72754288-72754310 CTTGGGAAAGGGTGGGAAGGGGG + Intronic
1152050860 17:77975453-77975475 CTGGGCAACTGGTGGAAAGATGG + Intergenic
1152519160 17:80845380-80845402 CTGGGGTGAGGGCGGGAGGAGGG - Intronic
1155758336 18:29530762-29530784 ATGGGGAAAGGGAGGTAAGAAGG + Intergenic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157465184 18:47937909-47937931 CTGGGGAAAAGGGAGCAAGATGG - Intergenic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158348569 18:56540743-56540765 GTGGGGACATGGCAGGAAGTGGG + Intergenic
1159299087 18:66539062-66539084 CTGGGTAAATGCTTGGAAGAGGG + Intronic
1159395029 18:67845948-67845970 CTGGAGAGATGGAGGCAAGATGG + Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1160517424 18:79486392-79486414 CTGCGGACAGGGCGGGAAGCCGG - Exonic
1160848988 19:1180670-1180692 CTGGGGAAGTGGGTGGAGGAAGG - Intronic
1161426338 19:4205520-4205542 CTGGGCAAATGGCAGTAGGAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161733598 19:5977492-5977514 GGGGGGAACTGGCGGGAAGTGGG + Intronic
1161983648 19:7642960-7642982 CTGGGGAAGTAGGGGGAAGAGGG - Intronic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1163919739 19:20277326-20277348 ATAGGGTAATGGTGGGAAGAGGG - Intergenic
1164618626 19:29681031-29681053 CTGGGGAAATGGTGGGTATGGGG - Intergenic
1164721269 19:30433319-30433341 TTGGGGAAGTGGGGGGAAGATGG - Intronic
1164781631 19:30897584-30897606 CTGGGGAGATGGCCAGAGGAGGG - Intergenic
1165148833 19:33749430-33749452 GTGGGGAGATGGGGGGATGATGG - Intronic
1165965314 19:39572953-39572975 CTGGGGACTTGGGGGGAAAAGGG - Intergenic
1165987505 19:39783026-39783048 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166235361 19:41451793-41451815 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1167387634 19:49173390-49173412 ATGGGTAAATGGATGGAAGATGG - Intronic
1167820315 19:51921890-51921912 ATAGGGTAATGGTGGGAAGAGGG - Intronic
1167933064 19:52884088-52884110 ATTGGGACATGGCAGGAAGATGG + Intronic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
927519597 2:23690874-23690896 CTGGGGAACTGGGGGGAGCAGGG - Intronic
929452235 2:42045942-42045964 ATGGGGAAATTGCTGGAAGGAGG + Intergenic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
930814815 2:55584493-55584515 TTGGGGAAAGGGTGGGAAGGGGG - Intronic
932588134 2:73044927-73044949 GAGGGGAAAGGGTGGGAAGAGGG + Intronic
932594211 2:73084081-73084103 CTGGGGAGCTGGCCGGGAGAGGG - Intronic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
935436742 2:103043840-103043862 TTGGGGACATGGGGGGAAGAGGG + Intergenic
935566357 2:104612205-104612227 CACGGGAAAAGGCAGGAAGAGGG - Intergenic
935794577 2:106628860-106628882 ATTGGGAAAAGGCTGGAAGAGGG - Intergenic
936315352 2:111420101-111420123 TTGAGGAAATGGGGGGAAAAGGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
936695046 2:114936136-114936158 TTGGGGAAAGGGTGGGAAGCAGG - Intronic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
941126280 2:161587776-161587798 CTGGGGAAATGGGGAGATGGTGG - Intronic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
942993007 2:182225112-182225134 CTTGGGAAAAGGCTGGAAAAAGG + Intronic
943996229 2:194769481-194769503 TTGGGGAAAGGGTGGGAAGCGGG - Intergenic
945409228 2:209488833-209488855 CTGGGGAAAGGGGGGGATGTGGG + Intronic
946622820 2:221577059-221577081 TTGGGGACTTGGGGGGAAGATGG - Intergenic
947212695 2:227722436-227722458 ATGGGGTAATGGTGGGGAGAGGG + Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
1168884867 20:1242064-1242086 CTGAGGAAAGGTGGGGAAGAGGG - Intronic
1168955892 20:1834148-1834170 CTGGGGATATTGCTGGAAAAGGG - Intergenic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170329569 20:15193716-15193738 CTGGGGAAATGAGAGGATGAGGG - Intronic
1171041181 20:21765150-21765172 AGGGGGAAATGGTGGGAAGTGGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172390397 20:34561372-34561394 CTGGGCACCTGGCTGGAAGATGG - Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172664063 20:36587055-36587077 TTGGGGAGATGGTAGGAAGAAGG - Intronic
1172771064 20:37382874-37382896 ATGGGGAAATGGGAGGCAGAGGG + Intronic
1174039268 20:47687447-47687469 CTGGGGAAATGGCGGGAAGATGG + Intronic
1174658303 20:52190542-52190564 CTGGGGGACTGGCGGGGAGGGGG - Intronic
1174910789 20:54605484-54605506 TTGGGGAGGTGGTGGGAAGAGGG - Intronic
1174951604 20:55047749-55047771 CTGGGGATATGGTGGTAAAAGGG + Intergenic
1175104227 20:56602985-56603007 CTGGGAAAAAGCCAGGAAGATGG + Intergenic
1175361829 20:58418008-58418030 CTGGTGAAATAGTGGGAACATGG + Intronic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175722491 20:61295717-61295739 CTGGGGAAAAGCGGGGAAGGAGG + Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176119790 20:63449085-63449107 CTGGGGCACTGGCAGGAGGACGG + Intronic
1176384603 21:6132776-6132798 AGGGGGAAAGGGCGGGAAGGGGG - Intergenic
1178349177 21:31859629-31859651 AGGGGGAAAGGGCGGGAAGGGGG - Intergenic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178793892 21:35725295-35725317 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1179738869 21:43405476-43405498 AGGGGGAAAGGGCGGGAAGGGGG + Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181487570 22:23241316-23241338 GGGGGGGAATGGCAGGAAGAGGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1183046095 22:35221447-35221469 CTGGGAAGATGGAGCGAAGAAGG + Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183145018 22:35982366-35982388 ATGGGGAGATGGGGGGAGGAGGG - Intronic
1184464475 22:44660703-44660725 CTGGGGAGATGGCTGGGAGCAGG + Intergenic
1184733017 22:46381371-46381393 TCTGGGAAATGGCAGGAAGAAGG + Intronic
1185415084 22:50705353-50705375 CTGGGGGAACGCCGGGAAGGAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949799154 3:7884209-7884231 CCAGGGAAATGGGGGAAAGATGG - Intergenic
951487417 3:23229438-23229460 AGGGGGAAAGGGTGGGAAGAGGG - Intronic
951508277 3:23473578-23473600 GTGGGGAAAGGGTGGGAAGGGGG - Intronic
951615584 3:24539996-24540018 CTGAAGAAAAGGAGGGAAGAGGG - Intergenic
952112583 3:30141138-30141160 ATGGGGAAATGTGGGGAACAGGG + Intergenic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954459891 3:50620320-50620342 CTGGGGCAACTGCGGGGAGAGGG - Intronic
954862950 3:53705290-53705312 CTGGGGAAATGGCACAAACAAGG + Intronic
955103986 3:55878396-55878418 ATGGGGAGATGGTGGGAGGAAGG - Intronic
955884813 3:63586492-63586514 CTGGGGATAGGGATGGAAGAAGG - Intronic
956990698 3:74759877-74759899 TCGGGGAAAGGGTGGGAAGAAGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
960013756 3:112862049-112862071 GTGGGGGAATGGTGGGAAGGTGG - Intergenic
960614061 3:119580778-119580800 CTGAGGAATTGGCTGAAAGAGGG + Intronic
961324711 3:126103334-126103356 CTGGGAAACAGGTGGGAAGACGG - Intergenic
961362354 3:126375997-126376019 CTGGGGGAATGGCGGGGCTAAGG - Intergenic
961545548 3:127630171-127630193 CTATGGAAATGGCGGGGAGAAGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961931276 3:130536033-130536055 CTGGAGAAATGGCTAGAATAAGG - Intergenic
962902799 3:139775752-139775774 GTGGGGACATGGCAGGAAGGTGG + Intergenic
962927526 3:140008563-140008585 CTGGCCAAATGGCGGGAACTGGG - Intronic
962982933 3:140507092-140507114 CTGGGCAGAGGGAGGGAAGAGGG + Intronic
962991109 3:140578211-140578233 GTGGGGAGAGGGCAGGAAGATGG - Intergenic
965493272 3:169366202-169366224 CTGGGGAGATTCCAGGAAGATGG + Intronic
965992955 3:174843245-174843267 CTGGGGAAGGGAGGGGAAGATGG - Intronic
966624850 3:182004844-182004866 CTGTGGAGCTGGCAGGAAGAAGG - Intergenic
966940867 3:184746308-184746330 ATGGGGAGGTGGCGTGAAGAAGG - Intergenic
967459081 3:189724472-189724494 CCGGGGAAAGGGTGGGAAGAGGG - Intronic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968193337 3:196686916-196686938 ATGGGGAAAAGGCAGGAAGGAGG - Intronic
968286897 3:197514097-197514119 CTGGGGTGATGGTGGGCAGAGGG - Intronic
968894933 4:3393965-3393987 ATGGGGAAATGGCTGGAATTTGG + Intronic
969108974 4:4829462-4829484 CAGGGAAAATGCAGGGAAGAGGG - Intergenic
970583249 4:17492340-17492362 CCTGGGAAATGGGGAGAAGATGG + Exonic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
973397804 4:49611545-49611567 CTGGGGAAAAGGCAGGAAACAGG - Intergenic
973792102 4:54387486-54387508 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
974276827 4:59731361-59731383 AGGGGGAAAGGGTGGGAAGAGGG + Intergenic
976157659 4:82164567-82164589 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
979303459 4:119114680-119114702 CTGGGGAAATGGAGGAAAAGGGG - Intergenic
980393842 4:132182220-132182242 ATGGGGAAATGGCTGGCAGGTGG + Intergenic
980401393 4:132290599-132290621 CTGGAGAAATGGTGGGATGGGGG + Intergenic
980617386 4:135248117-135248139 CTGAGGAAATGAGGGGTAGAGGG - Intergenic
981522388 4:145676722-145676744 CTGGGGCAATGGTGGGAGGCAGG - Intergenic
982803992 4:159740334-159740356 CAGGGGAAAGGGTGGGAAGTGGG - Intergenic
982983485 4:162172215-162172237 AGGGGGAAATGGTGGGAAGGGGG - Intergenic
984637627 4:182129062-182129084 CATGGGAAAAGGCGGGAATAGGG + Intergenic
984709290 4:182871767-182871789 CTGGGGAAGTGGTGGGGAGGTGG - Intergenic
985691299 5:1314237-1314259 CAAGGGAAATGGCAGGATGAGGG + Intergenic
985855240 5:2419214-2419236 CTGGGGAAAGGGGAGGGAGAAGG + Intergenic
985986874 5:3523314-3523336 CTATGGAGATGGCAGGAAGATGG - Intergenic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987348133 5:16996998-16997020 CTCGGGAAAGGGTGGGAAGGGGG + Intergenic
987393988 5:17403769-17403791 CTGGGACAATGTCAGGAAGATGG - Intergenic
988459724 5:31423377-31423399 CTGGGAACATGTCAGGAAGACGG - Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
989690287 5:44135403-44135425 CTGGGGAAAGAGTGGGAAGGGGG - Intergenic
990171386 5:53053660-53053682 CTTGGGAAATAGTGGGAAGAGGG - Intronic
990171468 5:53054780-53054802 GGGGGGAAATGGTGGGAAGCGGG + Intronic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
991003218 5:61803619-61803641 ATGGGGAATTGGTGGGAACACGG - Intergenic
991553005 5:67863391-67863413 CGGGGGAAAAGGTGGGAAGGGGG - Intergenic
992467036 5:77016162-77016184 CTGGGGTGATGGTGGGAAGGTGG + Intergenic
993750477 5:91659953-91659975 ATGGTGAAATGTGGGGAAGAAGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
996032450 5:118721218-118721240 TTGGGGAATTGGGGGGAAGGAGG + Intergenic
996136313 5:119846549-119846571 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
997580775 5:135015472-135015494 CCGGGAAAATGGAGGGAAGAAGG + Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
998371258 5:141663187-141663209 CTGGGGATATGGCAGTAAGCAGG - Intronic
998594577 5:143515559-143515581 ATGGGGAAAGGAAGGGAAGAAGG - Intergenic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999143535 5:149378294-149378316 CTTGGGGGATGGCTGGAAGAGGG - Intronic
1000275292 5:159728943-159728965 GAGGGGAAATGGGGGTAAGAAGG - Intergenic
1001190956 5:169630762-169630784 AAGGGGAAATGGTGGGAAGAGGG - Intergenic
1001209186 5:169794283-169794305 GTGGGGAAGTGGAGGGAAGGAGG - Intronic
1001285259 5:170418447-170418469 CTGGAGAAATGATGGGAAGAGGG - Intronic
1001654830 5:173341259-173341281 CAGGGGAAATGGCAGGCAGGTGG + Intergenic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1002419785 5:179139564-179139586 CTGGGGAAATGGGGGTAAGCGGG - Intronic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1004201369 6:13551194-13551216 CTGGGGAGAGGGCGGGAATAAGG + Intergenic
1004695293 6:18027540-18027562 GGGGGGAAATGGAGGCAAGATGG - Intergenic
1004828380 6:19449509-19449531 CTGGAGACGTGGCGGGGAGAGGG + Intergenic
1005436094 6:25813717-25813739 CTGGGTAGAGGGTGGGAAGAGGG - Intronic
1005877913 6:30028127-30028149 TCGGGGAAAGGGAGGGAAGAAGG + Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006082671 6:31576519-31576541 CTGGGGAACTGTTGGGGAGAAGG - Exonic
1006089954 6:31622514-31622536 CTGGGGGAAAGGAGGGAACATGG + Intronic
1006193693 6:32224180-32224202 CTGGGGAAGTAGGGGGAAGTAGG + Intergenic
1006209197 6:32378868-32378890 CTGGGGAAGTGGGGCGAATATGG + Intergenic
1006213251 6:32415312-32415334 CTTGGGGAATTGCGGGGAGAGGG + Intergenic
1006447695 6:34089046-34089068 ATGGGGAAATGGAGGCCAGAGGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007411986 6:41669771-41669793 CTTGGGAAAGGGTGGGAAGGGGG - Intergenic
1008004274 6:46393478-46393500 CAGGGGAAACGGTGGGATGAGGG + Intronic
1008409268 6:51154296-51154318 TTGGGGGAAGGGTGGGAAGAGGG - Intergenic
1009197804 6:60708351-60708373 CTGTGAAAATGGCGGGAAAGAGG - Intergenic
1009428681 6:63542269-63542291 AGGGGGAAAGGGTGGGAAGAGGG + Intronic
1009595969 6:65737164-65737186 CTAGGGAAATGGCTGTAAAAGGG - Intergenic
1011093005 6:83628000-83628022 AGGGGGAAAGGGTGGGAAGAGGG - Intronic
1011196756 6:84788478-84788500 ATGGGGAAAGGGTGGGAAGGGGG + Intergenic
1011319487 6:86074952-86074974 AGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1012027777 6:94019901-94019923 TTGGGGAAAGGGTGGGAAGGGGG - Intergenic
1012083873 6:94797823-94797845 CTTGGGAAAGGGTGGGAAGGGGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1014078924 6:117266639-117266661 CTGAGGAAATGGAAGGAAAATGG - Intronic
1014664276 6:124217068-124217090 CTGGGAAAATGGTGAGAGGATGG + Intronic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1016208651 6:141501849-141501871 CTTGAGAAATGCAGGGAAGAGGG - Intergenic
1017196705 6:151709130-151709152 CTGGGGCAGTGTCGGGCAGAGGG - Intronic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018712560 6:166507142-166507164 CTGGGAAGAGGGAGGGAAGAGGG - Intronic
1019615334 7:1956861-1956883 TTGGGGAAAGGGCTGGAAGCTGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1021174667 7:17437428-17437450 GTGGGGAATTGGAGGGCAGAAGG + Intergenic
1021478963 7:21094534-21094556 CTGGGGAAATGGGGGAAGGGTGG - Intergenic
1022132981 7:27421176-27421198 CTGGGGAAGTCTCGGGAAGAAGG + Intergenic
1024160158 7:46665939-46665961 CAGGGGAAATGGTAGGAAGGCGG - Intergenic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1025794323 7:64723828-64723850 AGGGGGAAAGGGTGGGAAGAAGG - Intergenic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1027731339 7:81877236-81877258 CTGGGAGAATTGGGGGAAGAGGG + Intergenic
1028383704 7:90228466-90228488 CTGGGCAAATGACTGGAAGGAGG - Intronic
1028784051 7:94772283-94772305 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1029201430 7:98841863-98841885 CGGGGGGCATGGCGGGCAGAGGG - Intergenic
1029371066 7:100151018-100151040 CTGGGCAAGTGGTGGTAAGAAGG + Intronic
1029585579 7:101468722-101468744 CTGGGGAAACTGTGGGAGGAGGG + Intronic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1030650191 7:112109227-112109249 GTGGGGAAATAATGGGAAGAAGG - Intronic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032491930 7:132330236-132330258 GTAGGGACATGGTGGGAAGAAGG + Intronic
1032529740 7:132610244-132610266 CTGGGGAATTTCTGGGAAGATGG + Intronic
1032581671 7:133108780-133108802 TTTGGGAAATGGCAGGAAGATGG - Intergenic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033432786 7:141304423-141304445 CTGGGCAGAAGGTGGGAAGAGGG - Intronic
1033457722 7:141517687-141517709 CTGAGGAAGTGGCTGGATGAGGG + Intergenic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035283013 7:157788982-157789004 CTTGGGAAATGGAGGCAGGAAGG - Intronic
1036575851 8:10027172-10027194 GTGAGGAAATGGCGGGGAGAAGG - Intergenic
1036694317 8:10964734-10964756 CTGGGGAAATCAAGGGATGAGGG - Intronic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037915386 8:22769859-22769881 CTGCAGCAATGGCGGGAGGAAGG - Intronic
1038027483 8:23605052-23605074 AGGGGGAAATGGTAGGAAGAGGG + Intergenic
1038714500 8:29979833-29979855 CTGGGGAAATCTGGGGAAGAAGG - Intergenic
1038765338 8:30422920-30422942 CTGGGGAAATGGGTGAAACAGGG + Intronic
1039454346 8:37697491-37697513 CGGGGGAAAGGGCGGGCAGGCGG - Exonic
1039542985 8:38386729-38386751 CTGGGGAACTGGCGGGGATGAGG - Intronic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1040392290 8:46960618-46960640 ATGGGGAAAGGGTGGGAAGGGGG - Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1041150787 8:54931367-54931389 CAGGGGAAAGGGCGGGAATGAGG + Intergenic
1042161054 8:65895965-65895987 CAGGGGAAATGGTGGGAGGGTGG + Intergenic
1043448670 8:80344279-80344301 CGGGGGAAATGGTGGGAGGGGGG - Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1043877136 8:85498258-85498280 AGGGGGAAAGGGTGGGAAGAGGG + Intergenic
1044119962 8:88382503-88382525 GGAGGGAAATGGAGGGAAGAGGG - Intergenic
1044629784 8:94267088-94267110 CTGGGCCAATGGAGGGAAGGAGG - Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1047002489 8:120586831-120586853 ATGGGCAAATGGGGGAAAGAAGG + Intronic
1047392974 8:124469349-124469371 TCGGGGAAAGGGTGGGAAGAGGG - Intergenic
1047606820 8:126482890-126482912 CAGGGGAAATGGTGGGATGCGGG - Intergenic
1048374510 8:133811147-133811169 CCGGGGAAAGGGCGGGAAGAGGG + Intergenic
1048503125 8:134996733-134996755 CTCGGGAAGTGGCTGGAAAAGGG + Intergenic
1048544375 8:135372683-135372705 GTGAGGACATGGGGGGAAGATGG + Intergenic
1049196037 8:141316174-141316196 CTGTGGAAATGCGGGGAAGGGGG + Intergenic
1049660584 8:143818076-143818098 CTGGGGAAGAGGCGGTGAGATGG + Intronic
1049908586 9:243659-243681 CAGGGGAAAGGTAGGGAAGAAGG - Intronic
1050652446 9:7789091-7789113 CTGGGGAATTGTAGGGAATATGG + Intergenic
1050663461 9:7909017-7909039 TTGGGGAAAGGGTGGGAAGGGGG + Intergenic
1050851599 9:10294175-10294197 CTTGGGAAATTGGGGGAAAAAGG - Intronic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1052290779 9:26837600-26837622 GTCGGGGAGTGGCGGGAAGAGGG + Intergenic
1052764687 9:32629377-32629399 CAGGGGAAATGGTAGGAAAATGG - Intergenic
1052847253 9:33348021-33348043 CTGGGGAAAGGACGGGAGGCGGG + Intronic
1054941005 9:70741817-70741839 TTGGGGAAAGGGTGGGAAGGGGG + Intronic
1055084554 9:72300775-72300797 CTGGGCAAATGGGGAGAAAAAGG + Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056897012 9:90560322-90560344 CAGGGGAAAGGGTGGGAAGTGGG + Intergenic
1057044904 9:91878205-91878227 CAAGGGAAATGGCAGGAAGCAGG + Intronic
1057314735 9:93960964-93960986 AGGGGGAAATGGGTGGAAGAAGG - Intergenic
1057951234 9:99370404-99370426 CTGGGGATATGGCCTGAACAAGG - Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1060966591 9:127715304-127715326 GTGGGGAAGGGGCGCGAAGAAGG + Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061635492 9:131905849-131905871 CTGGGTAGATGGGAGGAAGAAGG - Intronic
1061980747 9:134102115-134102137 CTGGGGAAATGGAGGCAAAGGGG + Intergenic
1062529911 9:136995284-136995306 CTGGGGAAGCTGCGGGATGAGGG + Exonic
1186303382 X:8226688-8226710 AGGGGGAAATGGTGGGAAGGGGG - Intergenic
1186348810 X:8722349-8722371 CGGGGGAAAGGGTGGGAAGGGGG - Intronic
1187281850 X:17863357-17863379 CTAAGAAAATGGAGGGAAGAAGG + Intergenic
1187600012 X:20818746-20818768 CGGGGGAAAGGGCAGGAAGGGGG + Intergenic
1188433131 X:30129552-30129574 TTGGGGACTTGGGGGGAAGAGGG + Intergenic
1189733455 X:44045878-44045900 CGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1192478555 X:71464984-71465006 CAGGGGAAATGGTAGGAAAATGG + Exonic
1192731425 X:73805805-73805827 CTGGGGAAAAGGCGGCAATGAGG + Intergenic
1192951549 X:76022876-76022898 CGGGGGAAAGGGTGGGAAGGGGG + Intergenic
1193009226 X:76657325-76657347 CTGGGGAAATGAGGGGGTGAAGG + Intergenic
1194486166 X:94489976-94489998 AAGGGCAAATGGGGGGAAGAAGG - Intergenic
1194527878 X:95001983-95002005 AGGGGGAAAGGGTGGGAAGAGGG - Intergenic
1195086346 X:101417944-101417966 TTGGGGAAAGGGCAGGAAGCTGG + Intergenic
1196090253 X:111733284-111733306 CGGGGGAAATGGTGGGAAGGGGG - Intronic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196816467 X:119668930-119668952 AGGGGGAAAGGGCGGGAAGGGGG - Intronic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1197423288 X:126264660-126264682 ATGGGGAAATGGCTGGCAGTTGG + Intergenic
1198019621 X:132645070-132645092 GTGGGGGAAAGGCTGGAAGAAGG - Intronic
1200003790 X:153074694-153074716 CCCGGGAGATGGCGGAAAGAAGG + Exonic