ID: 1174040288

View in Genome Browser
Species Human (GRCh38)
Location 20:47694513-47694535
Sequence GAACCCGGCGCCCAGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174040283_1174040288 -6 Left 1174040283 20:47694496-47694518 CCCAGGTGCATTTTCCAGAACCC 0: 1
1: 0
2: 0
3: 22
4: 147
Right 1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 133
1174040284_1174040288 -7 Left 1174040284 20:47694497-47694519 CCAGGTGCATTTTCCAGAACCCG 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 133
1174040282_1174040288 1 Left 1174040282 20:47694489-47694511 CCACAGGCCCAGGTGCATTTTCC No data
Right 1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG 0: 1
1: 0
2: 1
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174040288 Original CRISPR GAACCCGGCGCCCAGGAGTC AGG Intronic
900985964 1:6072924-6072946 GCACCCAGAGCCCAGGATTCAGG + Intronic
901004476 1:6165265-6165287 GTACCCTGAGCCCAGGAGACGGG + Intronic
902751031 1:18511185-18511207 GAGCTCTGAGCCCAGGAGTCAGG - Intergenic
906197228 1:43936599-43936621 GGCCCCGGCGCCCAGTAGGCTGG - Exonic
913234566 1:116768618-116768640 GAACACGGTGTCCAGGAGGCGGG - Exonic
914247856 1:145899184-145899206 GATCCCAGCGACCAGGAGTACGG + Exonic
914924603 1:151873375-151873397 GAACCCTGGGCCCAGGGGACCGG - Intergenic
915464672 1:156089903-156089925 GACCCAGGCGTCCAGGAGGCGGG + Intronic
916201991 1:162280962-162280984 GAACCCTGCCCCCAAGATTCTGG + Intronic
920092998 1:203467425-203467447 GAACCAGGATCCCATGAGTCTGG + Intergenic
920315106 1:205071239-205071261 GAATCTGGGGCCCAGCAGTCTGG + Intronic
924456587 1:244223512-244223534 GAGCCCGGCGGCAAGGAGCCTGG - Intergenic
1063700548 10:8380582-8380604 GAACCCGGGGCCGAGGAGACAGG - Intergenic
1067431998 10:46251182-46251204 GAACACAGGGGCCAGGAGTCGGG - Intergenic
1067465784 10:46497827-46497849 GAACCTGGGGCCCTGGGGTCTGG + Intergenic
1067578122 10:47420472-47420494 GAACACAGGGGCCAGGAGTCTGG + Intergenic
1067621403 10:47886779-47886801 GAACCTGGGGCCCTGGGGTCTGG - Intergenic
1071276174 10:84057509-84057531 GAACCAGGGGCTCAGGAATCAGG - Intergenic
1071579437 10:86756404-86756426 GAGCCCGGCGCCCAGTTGCCGGG - Intergenic
1073001846 10:100291609-100291631 GAACCTGGTGAGCAGGAGTCAGG - Intronic
1075719666 10:124577295-124577317 GACCCCTGTGCCCAGGAGGCTGG - Intronic
1076221954 10:128740930-128740952 GAACCCCAAGCCCTGGAGTCAGG + Intergenic
1076706760 10:132306609-132306631 GAGCCCAGCGCTCAGGAGCCAGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1076885747 10:133261682-133261704 GACCCCCCCGCCCAAGAGTCTGG - Intergenic
1077285497 11:1763606-1763628 GAGCCCGGCGCCCCGTAGGCGGG + Intronic
1077675585 11:4191075-4191097 GGACTCGGCTCCCAGGAGTGAGG - Intergenic
1078454850 11:11467088-11467110 GAACCTGGGGCCCGGGAGGCAGG + Intronic
1080223563 11:29934468-29934490 GAACCCGGCGCCGCAGAGGCTGG - Intergenic
1081522986 11:43900839-43900861 GAACCCAGTGCCCAGGAGGCAGG + Intronic
1081911791 11:46704670-46704692 GAGCCTGGAGCCCAGCAGTCTGG + Exonic
1083316338 11:61816860-61816882 AAACCCGGCGCGCAGGCGGCTGG - Exonic
1084154745 11:67307273-67307295 GAAGCCGAGACCCAGGAGTCAGG - Intronic
1089504934 11:118956663-118956685 GAACCTGGATGCCAGGAGTCGGG - Intronic
1090398653 11:126434944-126434966 GACCCCAGAGGCCAGGAGTCAGG + Intronic
1091712624 12:2752743-2752765 GAGCCCGGCCGCCAGGAGGCTGG + Intergenic
1092659493 12:10723006-10723028 GGACCCCGCGCCCAAGAGCCCGG - Exonic
1096482368 12:51951442-51951464 GAGCCCGGCGCGGAGGAGGCCGG - Intergenic
1101723842 12:107373736-107373758 GACCCTGGAGCCCAGGTGTCTGG + Intronic
1102569272 12:113817709-113817731 GACCCAGGGGCCCCGGAGTCTGG + Exonic
1104961427 12:132490190-132490212 GAGCCCGGTGCCCAGGAGCCCGG + Exonic
1105887472 13:24653932-24653954 GAGCACGGATCCCAGGAGTCTGG + Intergenic
1106319005 13:28620999-28621021 GCCCCAGGCTCCCAGGAGTCAGG - Intergenic
1108373755 13:49794617-49794639 GAACCTGAGGCCCAGAAGTCAGG + Intergenic
1113378914 13:109786080-109786102 GGGCCCGGCGCCCAGGGGTTGGG + Exonic
1113649779 13:112027298-112027320 GACCCAGGGTCCCAGGAGTCAGG + Intergenic
1113649803 13:112027373-112027395 GACCCAGGATCCCAGGAGTCGGG + Intergenic
1117249559 14:53922868-53922890 GAATCCAGAGCCCAGGAGTAGGG + Intergenic
1117798844 14:59422897-59422919 GAACCTGAGGCCCAGAAGTCAGG + Intergenic
1124818424 15:33019509-33019531 GGACCGGGCGCCCTGGAGTAGGG + Intronic
1125462469 15:39920179-39920201 AACCCCGGCGCCCGGGAGGCGGG + Exonic
1125728700 15:41881174-41881196 GAACCCAGGGCCCTGGAGTGAGG - Exonic
1132513073 16:353469-353491 GAAGCAGGCTCCCAGGAGTGGGG + Intergenic
1134482781 16:14633180-14633202 GAACCCCGCGGCCAGGAGTGGGG - Intronic
1142031312 16:87839877-87839899 AAACCCTGTGCCCAGGAGCCAGG + Intronic
1142425333 16:89999545-89999567 GAATCCAGAGCTCAGGAGTCAGG - Intergenic
1144942594 17:18951989-18952011 GATCCCAGAGCGCAGGAGTCAGG - Intronic
1147186843 17:38717620-38717642 GAAGGAGGAGCCCAGGAGTCAGG - Intronic
1148127818 17:45245911-45245933 GAAGCCGCTGCCCAGGAGGCAGG + Exonic
1148852430 17:50561478-50561500 GGAGCGGGCGCCGAGGAGTCGGG + Exonic
1149223296 17:54439888-54439910 GCTCCCGGCTCCCAAGAGTCGGG - Intergenic
1150488708 17:65560682-65560704 GGACCCGGCGCCCAGCGTTCCGG - Intronic
1152610479 17:81312884-81312906 GAACCCCGTGACCAGGAGTGGGG + Exonic
1154326036 18:13391019-13391041 GAAGGAGGCGCTCAGGAGTCCGG + Intronic
1160508929 18:79442543-79442565 GACCCCGGCTCCAAGGTGTCTGG - Intronic
1160837725 19:1132515-1132537 GAACCCAGCTCCCTGCAGTCTGG - Intronic
1161497628 19:4596301-4596323 GGACCCGGCGCCCAGGCTCCAGG + Intergenic
1162580719 19:11528754-11528776 GAAACCGGCTGCCAGGATTCTGG + Intronic
1165129036 19:33621144-33621166 GAACACGGGGCCCTGGATTCGGG - Intergenic
1166677559 19:44748858-44748880 CAGCGCGGCGCCCGGGAGTCCGG - Exonic
1166806978 19:45493235-45493257 GAACCCGGAGGACAGGAGTAGGG + Exonic
1167521591 19:49958968-49958990 AAACTGGGGGCCCAGGAGTCTGG - Intronic
1167756271 19:51415506-51415528 GAATTGGGGGCCCAGGAGTCTGG - Intronic
925170050 2:1744632-1744654 GAACCCGGGGCCCCAGCGTCCGG + Intronic
937123089 2:119454214-119454236 GCACCCGGTACCCAGGAGGCAGG + Intronic
945973526 2:216253257-216253279 AAACCCGGAGTTCAGGAGTCTGG + Intergenic
946408659 2:219505829-219505851 GAAACCGGCACCCAGAACTCAGG - Intronic
948393137 2:237626972-237626994 GAAGCCGGCGCCCAGGAGGCTGG + Intergenic
948463901 2:238143155-238143177 GCAGCCGGAGCCCAGGACTCTGG + Intronic
948634815 2:239328245-239328267 GAACCCAGCTCCCAGGCTTCTGG + Intronic
949077967 2:242073411-242073433 GAGCCCGGAGCCAAGAAGTCAGG - Intergenic
1172808524 20:37630791-37630813 GAAGCCGTGGCCCAGGAGTTGGG + Intergenic
1172996214 20:39072218-39072240 AGCCCCGGCCCCCAGGAGTCAGG - Intergenic
1173635434 20:44552628-44552650 GAACCTGGCGCACAGGGGTTGGG - Intronic
1174040288 20:47694513-47694535 GAACCCGGCGCCCAGGAGTCAGG + Intronic
1176032757 20:63021635-63021657 GCACCCACCGCCCAGGACTCTGG - Intergenic
1179628676 21:42663632-42663654 GCACCCCGCCCCCAAGAGTCGGG - Intronic
1179722887 21:43325363-43325385 GAGGCCAGCGCCCAGGAGACTGG - Intergenic
1180132225 21:45834131-45834153 GTCCACGGGGCCCAGGAGTCTGG + Intronic
1180178944 21:46109437-46109459 CAACCCGGCCCCCAGGCTTCAGG + Intronic
1182116916 22:27761917-27761939 GAACCCGGCTGCCAGGAGCTGGG + Intronic
1183585162 22:38749215-38749237 GAACACGGAACCCAGAAGTCAGG - Intronic
1184079869 22:42211824-42211846 GACCCCAGTGCCCAGGAGGCTGG - Exonic
949226339 3:1699890-1699912 TAACCCGGCCCCCAGGCATCAGG - Intergenic
950069631 3:10141941-10141963 GAGTCGGGCGCCGAGGAGTCCGG + Exonic
950500972 3:13363515-13363537 GAACCCTGTGCCAAGGAGACAGG + Intronic
953020048 3:39107413-39107435 CAACCCCGCGCCCGGGCGTCCGG - Intronic
960634244 3:119768132-119768154 CAGCCCGGCGCCCAGGCTTCAGG + Intergenic
964936496 3:162095062-162095084 GAACCCGGGGCCCTGGAATTGGG + Intergenic
965668432 3:171120912-171120934 GACCCCTGCGCCCTGGAGTCAGG + Intronic
969713468 4:8857597-8857619 GAACCCGCAGCCCAGAAGCCTGG + Intronic
976868619 4:89762613-89762635 AAACCTGGCACCCAGGAGTAAGG + Intronic
981516896 4:145619423-145619445 GCGCGCGGCGTCCAGGAGTCGGG + Intronic
982150567 4:152451517-152451539 GAATCCGGCTCCCAGAACTCTGG + Intronic
983432248 4:167665420-167665442 GAACCAGGCTCAGAGGAGTCTGG + Intergenic
984973525 4:185210263-185210285 GAGCTGGGCGGCCAGGAGTCGGG - Intronic
985548009 5:519701-519723 GAACCTGGCGCTCAGGGATCTGG + Intronic
985620503 5:952443-952465 GAACCTGGTGCCCCTGAGTCCGG + Intergenic
989213990 5:38884850-38884872 GAACCAGGCATCCAGGAGACTGG - Intronic
991371742 5:65926171-65926193 GGAGCCGGAGCCGAGGAGTCGGG - Intergenic
992089251 5:73303234-73303256 GAATGCAGCGCCCGGGAGTCAGG + Intergenic
998349595 5:141492056-141492078 GGAGCCGGCGCCTAGGAGGCTGG - Intronic
1002600911 5:180353465-180353487 GGACCCGGCCCCCAGGAGCCAGG + Intergenic
1003145962 6:3511023-3511045 GAAGCCAGCCTCCAGGAGTCTGG + Intergenic
1005898076 6:30195401-30195423 GAGCTCAGAGCCCAGGAGTCAGG + Intronic
1006189028 6:32196461-32196483 GAAACCGGAACCCAGGCGTCTGG - Intronic
1006932688 6:37697330-37697352 CAGCCCGGCCCCCTGGAGTCGGG - Exonic
1009588625 6:65637982-65638004 CAACCCGGCCCCCAGGCTTCAGG - Intronic
1019603053 7:1894896-1894918 GAACCAGGCACCCAGCAGTGGGG + Intronic
1019605486 7:1907978-1908000 GACCCCAGAGCTCAGGAGTCCGG + Intronic
1021562946 7:21986978-21987000 GAACCGGGAGTCCGGGAGTCCGG + Intergenic
1024089172 7:45921332-45921354 GAACGGCGCGCCCAGGAGTGGGG + Intronic
1025852117 7:65252174-65252196 GCACCCGCCGCCCAGGAACCGGG + Intergenic
1026867424 7:73832270-73832292 GAAACCCGCGCCCAGGAGTATGG + Exonic
1035168008 7:157002984-157003006 GAGCGCGGCGCCCAGGGGTGGGG + Intronic
1035536505 8:395212-395234 GAGCCCGGAGCCGAGAAGTCAGG - Intergenic
1036749688 8:11435980-11436002 GGACCCGGCACCCAGGAGCTGGG - Intronic
1039424111 8:37471505-37471527 GAAACCTTGGCCCAGGAGTCAGG - Intergenic
1039893108 8:41697627-41697649 GGCCCCGGCTCCCAGGAGGCAGG + Intronic
1047135992 8:122079127-122079149 GAATCCGGAGCCATGGAGTCTGG + Intergenic
1047584957 8:126261059-126261081 GAACACTTAGCCCAGGAGTCAGG - Intergenic
1049654101 8:143790215-143790237 GAACCCGGAGCCCCTGAGGCCGG + Intergenic
1051477570 9:17524867-17524889 GAAGCCGTCTCCCAGGTGTCAGG - Intergenic
1058884434 9:109312812-109312834 GAACCCGGAGCCCAGGGATGGGG + Intronic
1060976947 9:127770513-127770535 CAACCCTGTGCCCTGGAGTCAGG - Intronic
1062397470 9:136358252-136358274 GAGACCGGCGTCCAGGAGTGGGG - Exonic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1186669820 X:11757803-11757825 GCACCCGGCGGCCGGGAGGCTGG - Intergenic
1190062194 X:47218827-47218849 CAAGCCGGCGCCAACGAGTCCGG + Intronic
1192410254 X:70927605-70927627 GAACATGGAGCCCAGGAGGCTGG + Exonic
1197887680 X:131235398-131235420 GAACCAGGAGCTCAGGAGTTAGG + Intergenic
1199612806 X:149631999-149632021 GAGCGCGCCGCCCGGGAGTCTGG + Intergenic