ID: 1174042772

View in Genome Browser
Species Human (GRCh38)
Location 20:47711509-47711531
Sequence CAGCCAGATGGCCCGTCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174042772_1174042779 3 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042779 20:47711535-47711557 ATACCAACAGGGCTTCTTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 136
1174042772_1174042778 -8 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121
1174042772_1174042781 20 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162
1174042772_1174042777 -9 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174042772 Original CRISPR CAGCCAGATGGCCCGTCGTG GGG (reversed) Intronic
900936874 1:5771611-5771633 AGGCCAGATGGCCCGGCATGGGG + Intergenic
901560767 1:10068576-10068598 CAGGCAGATGGCCCGAGGTCAGG - Intronic
910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG + Intronic
910958645 1:92736531-92736553 CAGTCAGATGGCCAGTCAGGTGG - Exonic
911162755 1:94698036-94698058 GAGCCAGATGGCCCTCTGTGAGG - Intergenic
913540562 1:119816259-119816281 CAGCCAGATGGGCAGCAGTGTGG + Intergenic
917239713 1:172934389-172934411 CATCCAGATGGCCAGTCATCTGG + Intergenic
919726964 1:200891027-200891049 CAGCCAGCGGGCCCGGCGGGAGG + Intronic
923306817 1:232696173-232696195 CAGCCAGATTGCCCCAGGTGGGG + Intergenic
1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG + Exonic
1063314614 10:4989951-4989973 CTGCCAGAAGGCCCTGCGTGTGG - Exonic
1064032826 10:11894004-11894026 AGGCCAGATGGCCCCTCCTGTGG - Intergenic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1078659740 11:13277566-13277588 CAGCCCGCTGGCCAGTTGTGTGG - Intronic
1085512544 11:77095660-77095682 CAGACAGATGGCCTCTCCTGGGG - Intronic
1086373109 11:86174512-86174534 CAGCCACATGGCCCATAGGGAGG + Intergenic
1089614129 11:119685631-119685653 CATCCACATGGCCCATCATGGGG + Intronic
1091122016 11:133064742-133064764 CAGCCACACGGCCCGGCGCGGGG + Intronic
1096109741 12:49021560-49021582 CAGCCTGAGGGCCGGTGGTGGGG + Exonic
1098937118 12:76492713-76492735 CAGCTAGATGGTCCATCTTGAGG - Intronic
1104634682 12:130430297-130430319 CAGGCAGATGGCCCTCCCTGGGG + Intronic
1110091082 13:71449110-71449132 CAGGCAGATGGCCCGAGGTCAGG + Intronic
1110725394 13:78816929-78816951 CAGCCAACAGGCCCGTCCTGTGG - Intergenic
1113541284 13:111111813-111111835 CAGCCAGATGGCACGGCCTTAGG + Intergenic
1118702541 14:68448083-68448105 CAGCCAGTTGGCCCATACTGAGG + Intronic
1121990116 14:98549054-98549076 CAGCCTGATGGCCCGCTCTGCGG - Intergenic
1122967166 14:105136758-105136780 CAGGCAGATGCCCCGCCGAGGGG - Intergenic
1131373683 15:91905929-91905951 CAGCAAGGTGGCCCGACTTGGGG - Intronic
1132160727 15:99539208-99539230 CAGCTAGATGGCCCAGGGTGGGG + Intergenic
1132500924 16:284380-284402 CCCCCAGATGCCCCGTGGTGTGG + Exonic
1135358820 16:21793585-21793607 CAGCCAGATGCTCTGTCATGAGG + Intergenic
1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG + Intergenic
1138418426 16:56884501-56884523 CAGCCTGCTGGCCCCTCTTGGGG - Intronic
1144576653 17:16433880-16433902 CAGGCAGATGGCCAGTCATGTGG - Intronic
1147919018 17:43905367-43905389 CAGCCAGAGGGGCCGTGGAGAGG - Intronic
1152668108 17:81583514-81583536 CAGCCAGGTGGCAGGACGTGGGG - Intronic
1155367124 18:25059679-25059701 GAGCCCGATGCCCAGTCGTGTGG + Intergenic
1156457779 18:37304440-37304462 CAGCCAAAAGGCCCATGGTGGGG + Intronic
1156514978 18:37671687-37671709 CAGGCAGAGGGCAGGTCGTGGGG - Intergenic
1158985831 18:62815583-62815605 AAGCCAGCTGCCCTGTCGTGAGG - Intronic
1162472641 19:10881631-10881653 CAGCCAGATGGCAGGTCTTGGGG + Intronic
927055208 2:19360432-19360454 CAGCCAGAGGCCCTATCGTGTGG - Intergenic
933215841 2:79629120-79629142 CAGCCATATTGGCCCTCGTGTGG + Intronic
936014824 2:108950077-108950099 CAGCCAGCAGGCCCCTCCTGGGG - Intronic
940363586 2:152821305-152821327 CAGCCATATGGCCCATAATGAGG - Intergenic
948953197 2:241268492-241268514 TAGCCAGAAGGTCCGTCCTGAGG + Exonic
1173984357 20:47249705-47249727 CAGCCAGATGGCTCAGTGTGTGG + Intronic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1183453893 22:37911116-37911138 CAGCCAGCTGTCCCGTGCTGGGG + Intronic
1183723825 22:39577658-39577680 CAGCCAGGAGACCCGTCGAGAGG + Intronic
1184858349 22:47158697-47158719 CGGCCAGGTGGCCCGTCCTGTGG + Intronic
1185402245 22:50625225-50625247 CAGCCAGGTGGCCCGGGGCGAGG - Exonic
953890878 3:46750790-46750812 CAGCCTCATGGCCGGGCGTGGGG - Intronic
954971065 3:54652145-54652167 CAGCCAGAGTGACGGTCGTGTGG - Intronic
971207349 4:24583881-24583903 CAGCCAGAGGGGCCGTGGGGAGG - Intronic
973829728 4:54746591-54746613 CACCCAGGTGGCCTGTTGTGTGG - Intergenic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
997411216 5:133692409-133692431 CAGCCAGAGGGATCTTCGTGAGG - Intergenic
998565662 5:143213846-143213868 CAGCCAGATGGCAAGACATGAGG - Intronic
1000164478 5:158634699-158634721 CACCCAGATGGCCCATGGAGAGG - Intergenic
1005555547 6:26978221-26978243 CAGGGAGATGGCCCTTTGTGTGG + Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1023966947 7:44967707-44967729 CGGCCACATGGCCCGTAGAGTGG + Exonic
1024251462 7:47508802-47508824 CAGCCAGATGCCATGTTGTGAGG + Intronic
1026213599 7:68328626-68328648 CAGCCAGGTTGCCCGTGGAGAGG + Intergenic
1030502733 7:110380423-110380445 CAGCCAGTTGGCCCGGTGTGGGG - Intergenic
1033219960 7:139521253-139521275 CAACCAGATGGCCAGCTGTGGGG - Intergenic
1035423898 7:158754096-158754118 CAGGCAGGTGCCCCGTCGGGAGG + Intronic
1045001586 8:97883074-97883096 CAGGCAGATTGCCCGACGTCAGG + Intronic
1059781544 9:117533502-117533524 AAGATAGATGGCCCGTCTTGAGG + Intergenic
1061536135 9:131251512-131251534 CAGCAAGATGGCCTGTGGGGTGG + Intergenic
1190066549 X:47245328-47245350 CAACCAGATGGCCGGCTGTGAGG - Intronic
1199979662 X:152914010-152914032 CAGGCAGATGGCCTGTGGAGAGG - Intergenic
1200285918 X:154822209-154822231 CTGCCACATGGCCTGTCATGTGG - Intergenic