ID: 1174042777

View in Genome Browser
Species Human (GRCh38)
Location 20:47711523-47711545
Sequence ATCTGGCTGGAAATACCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174042766_1174042777 18 Left 1174042766 20:47711482-47711504 CCCGCTGCTTTCGGAGGACTTTC 0: 1
1: 0
2: 1
3: 4
4: 107
Right 1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 177
1174042772_1174042777 -9 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 177
1174042773_1174042777 -10 Left 1174042773 20:47711510-47711532 CCCACGACGGGCCATCTGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 177
1174042767_1174042777 17 Left 1174042767 20:47711483-47711505 CCGCTGCTTTCGGAGGACTTTCT 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 177
1174042771_1174042777 -8 Left 1174042771 20:47711508-47711530 CCCCCACGACGGGCCATCTGGCT 0: 1
1: 0
2: 1
3: 11
4: 249
Right 1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG 0: 1
1: 0
2: 0
3: 8
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174042777 Original CRISPR ATCTGGCTGGAAATACCAAC AGG Intronic
900797706 1:4719338-4719360 ATCTGTCTGGATTTCCCAACTGG - Intronic
903588466 1:24436323-24436345 AGCACTCTGGAAATACCAACAGG - Intronic
904899252 1:33843643-33843665 CTCTGGCTGGCATTACCACCAGG - Intronic
905751913 1:40472710-40472732 ACCTGACTAGAAATACCCACAGG + Intergenic
907254490 1:53168262-53168284 ACCTGACTAGAAATACCCACAGG - Intergenic
908302855 1:62779297-62779319 ATAAGGCTGGAAAGACAAACTGG - Intergenic
908909429 1:69055866-69055888 AACTGGCTACAAATATCAACAGG + Intergenic
911379571 1:97095845-97095867 ATCTGCCTAGAAATGACAACAGG + Intronic
913224833 1:116689744-116689766 ATCTAGGTGGAGAGACCAACAGG + Intergenic
913524134 1:119675066-119675088 TGCTGGCCGCAAATACCAACAGG + Intronic
915594181 1:156887125-156887147 TTCTGGCTGGAAACACCCATAGG - Intergenic
916106263 1:161434879-161434901 ACCTGACTAGAAATACCCACAGG + Intergenic
916124501 1:161557276-161557298 ATCTAACTGGAAATAGCATCAGG + Intergenic
916134392 1:161638626-161638648 ATCTAACTGGAAATAGCATCAGG + Intronic
919085400 1:192915082-192915104 AACTGGCAAGACATACCAACTGG + Intergenic
922484963 1:225966811-225966833 ACCTGACTAGAAATACCCACAGG + Intergenic
923301308 1:232643111-232643133 ATCTATCTGGAAATAGCATCAGG - Intergenic
924680376 1:246224992-246225014 AGATGGCTGGACATACGAACGGG + Intronic
1065949704 10:30641009-30641031 CTCTGGTTGGAAGTTCCAACTGG + Intergenic
1066258642 10:33706552-33706574 ATCTAGTTAGAAATACCTACTGG - Intergenic
1069332761 10:67312565-67312587 ATCTCGCTGGAAATAATAAGGGG + Intronic
1071701631 10:87945210-87945232 ATCTGGCTGGAATTTCTACCTGG - Intronic
1072541839 10:96404221-96404243 ACCTGACTAGAAATACCCACAGG + Intronic
1073318733 10:102600867-102600889 AGCTGGCTGGAGAAACCTACAGG - Intronic
1073647837 10:105324496-105324518 CCCTGGCAGGAAATTCCAACTGG + Intergenic
1077586273 11:3455978-3456000 ACCTGACTAGAAATACCGACAGG - Intergenic
1077597451 11:3546328-3546350 ACCTGACTAGAAATACCCACAGG + Intergenic
1077603859 11:3593684-3593706 ACCTGACTAGAAATACCCACAGG - Intergenic
1081357687 11:42132910-42132932 ATGTGGCTGGATTTACCAAATGG + Intergenic
1083192424 11:61061822-61061844 ATCTGGATGGAAATATCAAGTGG + Intergenic
1084253556 11:67922233-67922255 ACCTGACTAGAAATACCCACAGG + Intergenic
1084819326 11:71673693-71673715 ACCTGACTAGAAATACCCACAGG - Intergenic
1090473010 11:126996678-126996700 GCCTGGCTGGAAACACCAAAAGG - Intronic
1090496371 11:127216809-127216831 AAGTGGATGGAAATCCCAACAGG + Intergenic
1094081120 12:26536914-26536936 ATCTGTCTTGAAATAACAATGGG + Intronic
1100037634 12:90272516-90272538 ATCTAGCTAGAAATATCAATTGG + Intergenic
1100393469 12:94164273-94164295 AGGTGGGAGGAAATACCAACTGG - Intronic
1106335064 13:28776648-28776670 AGCTGCCAGGAAGTACCAACTGG - Intergenic
1109236734 13:59830842-59830864 ATCTGGATTCAAATCCCAACTGG + Intronic
1111497651 13:89073238-89073260 ATGTGGCTGGAAAAATAAACTGG + Intergenic
1113262359 13:108578645-108578667 GTCTGGCTGGAAAAACAACCTGG + Intergenic
1114603174 14:23972596-23972618 ACCTGACTAGAAATACCCACAGG - Intronic
1114607540 14:24009721-24009743 ACCTGACTAGAAATACCCACAGG - Intergenic
1114608152 14:24015077-24015099 ACCTGACTAGAAATACCCACAGG - Intergenic
1114717032 14:24837884-24837906 GGATGGCTGGAAATAACAACTGG + Intronic
1114730950 14:24992067-24992089 ATCTGGTTGGAAAAACAGACCGG - Intronic
1120909710 14:89655095-89655117 ATGTGGCTGCAAATACAAAGTGG + Intergenic
1122030192 14:98906372-98906394 ATCTGGCTAGAAATTCCGAAGGG + Intergenic
1125891442 15:43270005-43270027 ATCGGGCAAGAAATACGAACTGG - Intergenic
1127832211 15:62760888-62760910 ATCTGGCTAGAGTTACCAAGGGG - Intronic
1129918924 15:79301939-79301961 ATCTTGCTGGTAAAACCATCTGG + Intergenic
1131797490 15:96034558-96034580 TTCTGGCTGGAATTACCCAGTGG - Intergenic
1131946610 15:97629127-97629149 ACCTGACTAGAAATACCCACAGG - Intergenic
1132831720 16:1931810-1931832 ACCCGACTGGAAATACCCACAGG + Intergenic
1133262348 16:4559165-4559187 ATCCAGCTGGACACACCAACGGG - Intronic
1133843961 16:9437367-9437389 GTATGGCTTGAAATACCACCCGG - Intergenic
1134007777 16:10829474-10829496 ATCCGACTAGAAATACCCACAGG - Intergenic
1138618673 16:58194443-58194465 ATCTGGATAGAAATGCCACCGGG + Intronic
1139555161 16:67703580-67703602 TTCTGTCTGGAATTACCACCAGG + Intronic
1140192537 16:72830100-72830122 ATCTATCTGGAAATACCTAATGG - Intronic
1142276443 16:89121286-89121308 ATCTGGTTAGAAATATGAACTGG + Intronic
1149441830 17:56680622-56680644 TTCTGCCTGGAAATGCAAACAGG - Intergenic
1152962873 18:90237-90259 ATCTTGCAAGAAATACCGACAGG - Intergenic
1156872634 18:41965196-41965218 ATCTGGGAGGAAAAACCAAGAGG - Intronic
1157322618 18:46646216-46646238 ATCTGGCTGAGAATATCCACTGG - Intronic
1158251574 18:55494088-55494110 ATCTAGCTGTCAATGCCAACTGG - Intronic
1162291465 19:9784089-9784111 ACCTTGCGAGAAATACCAACAGG - Intronic
1164055680 19:21620249-21620271 ACCTGACTAGAAATACCCACAGG - Intergenic
1167940839 19:52944605-52944627 ATCTTGCGAGAAATACCCACAGG - Intronic
1168358591 19:55718840-55718862 ACCTGACTAGAAATACCCACAGG + Intronic
924967912 2:95008-95030 ACCTGACTAGAAATACCCACAGG + Intergenic
926686856 2:15704686-15704708 AGCTGCCAGGAAATTCCAACAGG - Intronic
927092257 2:19720940-19720962 ATCTGGATGGAGATGCCAATAGG - Intergenic
930214213 2:48677239-48677261 ATCTCAATGAAAATACCAACAGG - Intronic
932607309 2:73174020-73174042 ATTTGGCTGGAAAGAGAAACAGG + Intergenic
935867722 2:107408965-107408987 ATCTGACTGGAAATACATACTGG + Intergenic
937040400 2:118816233-118816255 CTGTGGCTGGAAAAACAAACTGG - Intergenic
939979790 2:148766363-148766385 ATCTGGGTAGAAAAACCAATTGG - Intronic
943117779 2:183694252-183694274 ATCTGTCTGGAATTATCAAATGG - Intergenic
1171272795 20:23829347-23829369 ACCTGACTAGAAATACCCACAGG - Intergenic
1172338510 20:34136533-34136555 ATCTTGCGAGAAATACCCACAGG + Intergenic
1172472798 20:35212931-35212953 ATCAGACTGCAAATACCAAAAGG - Intergenic
1174012836 20:47464365-47464387 ATCTGGCCGGAAATGTCAATCGG + Intergenic
1174042777 20:47711523-47711545 ATCTGGCTGGAAATACCAACAGG + Intronic
1174791176 20:53479883-53479905 ATCTGGCTGAAAATATTAACAGG + Intronic
1174930892 20:54813426-54813448 ATCTGGCTGGTAATACACTCTGG - Intergenic
950752986 3:15145554-15145576 ACCTGACTAGAAATACCCACAGG - Intergenic
951556582 3:23926905-23926927 AGCTGGCCTGAAATACCAATAGG + Intronic
952905336 3:38136430-38136452 ATCTGACGAGAAATACCCACAGG + Intronic
953025100 3:39140481-39140503 CTCTGGCAGGAAGTCCCAACAGG - Intergenic
956236910 3:67082665-67082687 ACCAGGCTGCAAATGCCAACAGG + Intergenic
956817888 3:72925011-72925033 ATCGGTCTGGAAACACTAACTGG + Intronic
957045882 3:75374188-75374210 ATCCGACTAGAAATACCCACAGG - Intergenic
957069957 3:75559952-75559974 ACCTGACTAGAAATACCCACAGG + Intergenic
958500691 3:94904573-94904595 ATCTGGCAGTAAATTTCAACAGG - Intergenic
958761618 3:98316158-98316180 ATCTGACGAGAAATACCCACAGG - Intergenic
958765506 3:98362580-98362602 ACCTGACTAGAAATACCCACAGG - Intergenic
960134692 3:114093427-114093449 TGCTAGCTGAAAATACCAACTGG + Intergenic
961047672 3:123720680-123720702 ATCTGGCTGCAAATTCCCAGAGG + Intronic
961270290 3:125682934-125682956 ATCTGGCTGCAAATTCCCAGAGG - Intergenic
961285531 3:125799276-125799298 ACCTGGTTAGAAATACCCACAGG - Intergenic
961875003 3:130015600-130015622 ACCTGACTAGAAATACCCACAGG - Intergenic
962309836 3:134317624-134317646 ATCTGCCTGGAAATGCCTAGTGG + Intergenic
965600340 3:170447920-170447942 ATCTGTTTTGAAAAACCAACAGG - Intronic
965937044 3:174127395-174127417 ATCTGCCAGAAAATAACAACAGG - Intronic
967063292 3:185891574-185891596 ATCAGGCAGCAAATATCAACAGG - Intergenic
969735670 4:8988379-8988401 ACCCGACTAGAAATACCAACAGG + Intergenic
969786981 4:9466173-9466195 ACCTGACTAGAAATACCCACAGG + Intergenic
969801260 4:9567339-9567361 ACCTGGCTAGAAATACCCACAGG - Intergenic
971720000 4:30232928-30232950 TTCTGACTAGAAATACCCACAGG - Intergenic
974318583 4:60314384-60314406 AGCCACCTGGAAATACCAACAGG + Intergenic
974945956 4:68529224-68529246 ACCTGACTAGAAATACCCACAGG + Intergenic
975268944 4:72406216-72406238 AGCTGGCAGTAAATACCAACAGG + Intronic
975288624 4:72649991-72650013 ATATGGTTGGAAAAGCCAACTGG - Intergenic
977078063 4:92483842-92483864 GTGTGGCAGGAAACACCAACAGG - Intronic
977446948 4:97142661-97142683 ATATGGCTGTAAAAACCAGCAGG - Intergenic
977676525 4:99754506-99754528 CTCTGGTTGGAAATACCACAGGG + Intergenic
978414546 4:108461597-108461619 ATCAGGCTAGAAATAGCATCAGG + Intergenic
979082685 4:116362256-116362278 ATCTGCCTGGAAATAAACACTGG - Intergenic
979194392 4:117903013-117903035 AGCAGGCTGGAAATTCCAGCAGG + Intergenic
980332424 4:131426737-131426759 ATCAGGCTGGAAATTCCAGAAGG - Intergenic
980606933 4:135104579-135104601 AGCTGGTTTAAAATACCAACTGG - Intergenic
982020277 4:151196119-151196141 AGCTGGGTGGAAATTCAAACAGG + Intronic
982676910 4:158386699-158386721 ATCTGGGTTGAAATAACAAATGG + Intronic
987493355 5:18610798-18610820 ATGTGACAGGACATACCAACAGG + Intergenic
988126212 5:27041521-27041543 CTCTGGCTTGAAATACCCTCAGG + Intronic
988455486 5:31383671-31383693 ATCTAGCTGGAAATGAAAACTGG + Intergenic
988988661 5:36647276-36647298 ATGTGGCTGGAAATAGAAATTGG - Intronic
991294116 5:65062711-65062733 AGCTGGATTGAGATACCAACCGG - Intergenic
996573419 5:124957654-124957676 ATGTTGCTGGAAAAACAAACGGG - Intergenic
999544695 5:152614627-152614649 CTCTGGCTGGAAACTACAACAGG - Intergenic
999562490 5:152819909-152819931 AGCTAACTGGAAATACCAAAAGG + Intergenic
1000955449 5:167537270-167537292 ATCTAGCTGAAAAAACCAACTGG - Intronic
1001914412 5:175547654-175547676 ATCAGGCGGGAAACACCACCCGG + Intergenic
1007624841 6:43239516-43239538 ACCTGACTAGAAATACCCACAGG - Intergenic
1008585796 6:52947723-52947745 ACCTGACTAGAAATACCCACAGG - Intergenic
1009193374 6:60655965-60655987 ACCTGACTAGAAATACCCACAGG + Intergenic
1009193786 6:60660928-60660950 ACCTGACTAGAAATACCCACAGG + Intergenic
1009775908 6:68205983-68206005 AACTGCCTGGAAATTCTAACTGG + Intergenic
1010897523 6:81382744-81382766 ATTTTGCTGAAAATACCAAGAGG + Intergenic
1010974542 6:82297448-82297470 AACTGGCTGGAAATACTGAAGGG - Intergenic
1011788979 6:90877707-90877729 ATGTGGCTGGAAATGACAGCAGG - Intergenic
1015285300 6:131479599-131479621 ACCTGACGGGAAATACCCACAGG + Intergenic
1015972696 6:138758690-138758712 ATCTGGAAGAAAATACCAATAGG + Intronic
1016212096 6:141549685-141549707 ATCAGGCTGGAAACTCCAATAGG + Intergenic
1018973807 6:168548260-168548282 ATCTGGGTGTAAATGGCAACTGG + Intronic
1020611363 7:10401637-10401659 ATCTGGGGGGAAATACAAGCTGG - Intergenic
1023100140 7:36709292-36709314 AACTGGCTGCAAAAACCAGCTGG - Intronic
1023511609 7:40959432-40959454 AGCTGGCTGGAAGTTCAAACTGG - Intergenic
1024979462 7:55145271-55145293 ACAGGGCTGGAAACACCAACAGG - Intronic
1026771589 7:73204579-73204601 CTGTGGCTGGAACTTCCAACTGG - Intergenic
1027012455 7:74757975-74757997 CTGTGGCTGGAACTTCCAACTGG - Intronic
1027075585 7:75188078-75188100 CTGTGGCTGGAACTTCCAACTGG + Intergenic
1029946500 7:104538919-104538941 CTCTGGCTGGGAACTCCAACAGG - Intronic
1030643484 7:112032665-112032687 ATATGGCTGGAAATAAAATCTGG - Intronic
1031007953 7:116496012-116496034 ATCTGGCCCAAAATGCCAACAGG + Intronic
1033250877 7:139758099-139758121 ATCCCAATGGAAATACCAACAGG + Intronic
1033473887 7:141672269-141672291 ATAAGGCTGTAAATACCAAGAGG - Intronic
1035843479 8:2837820-2837842 ATCTGAATGCAAATATCAACAGG - Intergenic
1036247084 8:7127012-7127034 ACCTGACTAGAAATACCCACAGG - Intergenic
1036375762 8:8198156-8198178 ACCTGACTAGAAATACCCACAGG + Intergenic
1036853768 8:12224987-12225009 ACCTGACTAGAAATACCCACAGG - Intergenic
1036875143 8:12467497-12467519 ACCTGACTAGAAATACCCACAGG - Intergenic
1038510455 8:28129642-28129664 ATGTGGCTAGAGACACCAACAGG + Exonic
1039710894 8:40055120-40055142 AACTGGCTGGAATTACTGACTGG - Intergenic
1039978013 8:42383572-42383594 ATCTGGCTGGGAATAGCACCAGG + Intergenic
1045278091 8:100724452-100724474 AGCTGGCTGGAAATAAAAAGAGG - Intergenic
1047382448 8:124375805-124375827 ATCCTGCTGGAAAGACCAAATGG + Intergenic
1047974442 8:130115320-130115342 AGCAGGCTGGAAATCCCAGCAGG - Intronic
1049424092 8:142530390-142530412 CTCAGGCTGGAAAGCCCAACTGG - Intronic
1049876018 8:145021269-145021291 ACCTGACTAGAAATACCCACAGG - Intergenic
1054966598 9:71035048-71035070 ATTGGGCTGGAATTTCCAACAGG - Intronic
1055129617 9:72759876-72759898 ATGTTGCTGGAAATTACAACAGG - Intronic
1055144436 9:72916014-72916036 ATCTGGCCCAAAATGCCAACAGG - Intronic
1060831126 9:126717480-126717502 ACCTGACTAGAAATACCCACAGG + Intergenic
1062735266 9:138133882-138133904 ATCTTGCAAGAAATACCGACAGG + Intergenic
1185575877 X:1171893-1171915 ACCCGACTGGAAATACCCACAGG + Intergenic
1186510515 X:10126570-10126592 CTGTGGCTGGAAATACAAACAGG + Intronic
1193770655 X:85583640-85583662 AAGTGGCTGGAAATTCAAACTGG + Intergenic
1194219284 X:91171249-91171271 ACCTGACTAGAAATACCCACAGG + Intergenic
1194560996 X:95420106-95420128 AACTAGCAGGAAATACCCACAGG - Intergenic
1194776713 X:97974065-97974087 ATATGGCTGGAAATAAAAGCAGG - Intergenic
1198544933 X:137681454-137681476 ATTTAGATGGAAGTACCAACAGG - Intergenic
1199402866 X:147420117-147420139 ATCTGGCTGGAAATGCAGGCAGG + Intergenic
1200555798 Y:4635006-4635028 ACCTGACTAGAAATACCCACAGG + Intergenic
1200932875 Y:8712854-8712876 AGCTGGCTGGAGTTACCCACAGG - Intergenic