ID: 1174042778

View in Genome Browser
Species Human (GRCh38)
Location 20:47711524-47711546
Sequence TCTGGCTGGAAATACCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 121}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174042773_1174042778 -9 Left 1174042773 20:47711510-47711532 CCCACGACGGGCCATCTGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121
1174042767_1174042778 18 Left 1174042767 20:47711483-47711505 CCGCTGCTTTCGGAGGACTTTCT 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121
1174042766_1174042778 19 Left 1174042766 20:47711482-47711504 CCCGCTGCTTTCGGAGGACTTTC 0: 1
1: 0
2: 1
3: 4
4: 107
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121
1174042772_1174042778 -8 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121
1174042771_1174042778 -7 Left 1174042771 20:47711508-47711530 CCCCCACGACGGGCCATCTGGCT 0: 1
1: 0
2: 1
3: 11
4: 249
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121
1174042775_1174042778 -10 Left 1174042775 20:47711511-47711533 CCACGACGGGCCATCTGGCTGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG 0: 1
1: 0
2: 2
3: 17
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174042778 Original CRISPR TCTGGCTGGAAATACCAACA GGG Intronic
900474790 1:2870968-2870990 TCTGCCTGGAGACCCCAACAGGG + Intergenic
903116759 1:21184709-21184731 TCGGGCTGGAAACACCCTCAAGG + Intergenic
903588465 1:24436322-24436344 GCACTCTGGAAATACCAACAGGG - Intronic
904102136 1:28040452-28040474 TCAGACTGGAAATATCAATATGG + Intronic
905931531 1:41791417-41791439 ACTGGGTGGAACTACCAAGAAGG + Intronic
906375515 1:45293609-45293631 TCTTGCTGGGATTACCACCATGG - Intronic
906522884 1:46477650-46477672 CCTGGCTGGAATTACCCAAAGGG + Intergenic
909415273 1:75399298-75399320 TCTGGCTGAAAATACCCAACAGG + Intronic
911744046 1:101419519-101419541 TTTGGCTGGACATGCCACCATGG - Intergenic
912113099 1:106368065-106368087 TCTGGGTGAAAATACTAGCAGGG + Intergenic
915445949 1:155975094-155975116 TCTGGTTGGAAATATCATCTAGG - Intronic
915594180 1:156887124-156887146 TCTGGCTGGAAACACCCATAGGG - Intergenic
919121497 1:193346421-193346443 TCTGTGTGAAAATACCCACAGGG - Intergenic
920391094 1:205602321-205602343 TCTGGCTGGAAAGAGAAACGTGG + Exonic
923464828 1:234239084-234239106 TGAGGCTGGAATTATCAACAAGG + Intronic
1063132436 10:3189763-3189785 TGAGGCTGGAGATACCAGCAGGG - Intergenic
1063582986 10:7326072-7326094 CCTGGATTGAAATATCAACAGGG + Intronic
1064314277 10:14240242-14240264 TCTGTCTGAAACTTCCAACAGGG - Intronic
1065211943 10:23412486-23412508 TCTGTCTGGAAAAAACAAAAAGG + Intergenic
1065949705 10:30641010-30641032 TCTGGTTGGAAGTTCCAACTGGG + Intergenic
1069585327 10:69596632-69596654 TCTGGCTGGAATCAACAAAAGGG + Intergenic
1069765190 10:70851484-70851506 TCTGGCTGGAAATGTCAAAATGG + Intronic
1071891088 10:90008213-90008235 TCAGGCTTTAAAGACCAACATGG - Intergenic
1075722581 10:124596063-124596085 TCTGGCTGCACAGAACAACACGG - Intronic
1079409289 11:20172074-20172096 TCTTCCTTGAAATACTAACAGGG + Intergenic
1082173691 11:49036542-49036564 TCTGACTGTAAATACAGACACGG - Intronic
1086692077 11:89799550-89799572 TCTGACTGTAAATACAGACACGG + Intronic
1086713722 11:90040106-90040128 TCTGACTGTAAATACAGACACGG - Intronic
1088905374 11:114151510-114151532 TTTTGCTGGAAAGACCAGCATGG - Intronic
1090473008 11:126996677-126996699 CCTGGCTGGAAACACCAAAAGGG - Intronic
1093048419 12:14479738-14479760 TTTGCCTGGAAATGCCAACAAGG - Intronic
1095627276 12:44330861-44330883 TCTGGATAGAAGTAGCAACAGGG + Intronic
1104119096 12:125781225-125781247 TCTATATGGAAACACCAACAAGG + Intergenic
1106657914 13:31767132-31767154 TTTGGTTTGAAATACCATCAAGG + Intronic
1106660371 13:31793508-31793530 TCTGAATGGAAATACCAGGAAGG + Intronic
1108683501 13:52799306-52799328 TCTGGTTGGAAATAGACACAAGG + Intergenic
1109631172 13:65048714-65048736 TGTGGCTGGACATAACCACATGG + Intergenic
1117386831 14:55223330-55223352 TCTTGTAGGAAATACAAACAAGG - Intergenic
1120856904 14:89220517-89220539 CCTGGCTGCAAATACACACACGG + Intronic
1124597336 15:31101993-31102015 CCTGGCTGGAAATGTCAGCAGGG + Intronic
1124827779 15:33115747-33115769 TCTGGCCAGAAATAGCAACATGG - Intronic
1125016332 15:34939657-34939679 TCCTGCTGGAAATACAAAGAAGG + Intronic
1129091500 15:73156399-73156421 CCTACCTGGAACTACCAACATGG - Intronic
1130201062 15:81827218-81827240 CAGAGCTGGAAATACCAACAGGG + Intergenic
1130870662 15:87969257-87969279 ACAGGCTGGAAACACCCACAGGG + Intronic
1131284162 15:91043733-91043755 TCTGGGTGGCAACACCAGCAGGG - Intergenic
1132093592 15:98965743-98965765 TGAGGCTGGAAAGCCCAACAGGG + Intergenic
1133843960 16:9437366-9437388 TATGGCTTGAAATACCACCCGGG - Intergenic
1142593807 17:1019911-1019933 TCAGGCTGGGAAGACCACCAGGG + Intronic
1148102639 17:45102002-45102024 TCTGGGTGGAAACCCCAGCATGG + Intronic
1151122137 17:71804667-71804689 TCTGTCTTGATATTCCAACATGG - Intergenic
1161057336 19:2197309-2197331 TCTGGCCGGAAGTTCCCACATGG + Intronic
1162422568 19:10574319-10574341 TCTGGCTCAGAAAACCAACAAGG - Intronic
1166592384 19:44011336-44011358 TCTTTCTGTAAAGACCAACAAGG + Exonic
1168663833 19:58187329-58187351 TCTGGCTGGAAATACACACCAGG - Intronic
930214212 2:48677238-48677260 TCTCAATGAAAATACCAACAGGG - Intronic
931281837 2:60801190-60801212 TCTGGCCTGAACTACAAACATGG - Intronic
933574903 2:84056127-84056149 TGTGGCAGGAAACACCAACTAGG + Intergenic
936288721 2:111201229-111201251 TCTGCCTGGAAAGACCGTCAGGG + Intergenic
937040399 2:118816232-118816254 TGTGGCTGGAAAAACAAACTGGG - Intergenic
937076402 2:119110495-119110517 TCTACCTGGAAATATGAACAGGG + Intergenic
941005978 2:160247542-160247564 ACTGGCATGAAATACTAACATGG + Intronic
941094219 2:161217381-161217403 TCTGGCTGGAAGAACCAAGAAGG - Intronic
943335047 2:186603284-186603306 ACTGGCAGGAAATAACAATATGG - Intronic
948976726 2:241468033-241468055 GCCGGCTGGAAATCCCCACAGGG - Intronic
1170299325 20:14865237-14865259 TCTGGCAGGAGATAGCATCATGG - Intronic
1174042778 20:47711524-47711546 TCTGGCTGGAAATACCAACAGGG + Intronic
1174791177 20:53479884-53479906 TCTGGCTGAAAATATTAACAGGG + Intronic
1175735025 20:61379398-61379420 TCTCGCTGTAAATACCAAGCAGG + Intronic
1178958631 21:37044473-37044495 CCTGGATGGAAATTCCGACAGGG - Intergenic
1180647728 22:17353425-17353447 TCTGGCTGCACACACCAACATGG - Intergenic
1182738261 22:32546685-32546707 ACTGGCTGGAAATCCCTCCAAGG + Intronic
1183953424 22:41365287-41365309 TCTGGCTGGAAACAGCAGTAAGG + Intergenic
1184817851 22:46885559-46885581 ACAGGCTTGAAATAACAACAAGG + Intronic
949859728 3:8494422-8494444 TCTGGCTGCAAATACTCAAAGGG + Intergenic
951294238 3:20914422-20914444 TCTGGCTGGATATACTCACATGG + Intergenic
951400457 3:22226940-22226962 TCTGCCTGCAAATGCCAATATGG + Intronic
951556583 3:23926906-23926928 GCTGGCCTGAAATACCAATAGGG + Intronic
951999319 3:28767554-28767576 TATGTGTGGAAATACCAAGATGG + Intergenic
954795121 3:53157401-53157423 CCTGGCAGGTAACACCAACATGG + Intronic
955824643 3:62932754-62932776 TTTGGCTGGAGCCACCAACATGG - Intergenic
955955714 3:64287488-64287510 TCTGGAAGGGAAGACCAACATGG - Intronic
956264243 3:67379683-67379705 TCTGGGTGGAAAGCCCAGCAAGG - Intronic
958500690 3:94904572-94904594 TCTGGCAGTAAATTTCAACAGGG - Intergenic
961340489 3:126213897-126213919 CCTGGCTGGAATCACGAACATGG - Intergenic
963286436 3:143438659-143438681 TCAGTCTGGAAAGACCCACAGGG + Intronic
967063291 3:185891573-185891595 TCAGGCAGCAAATATCAACAGGG - Intergenic
968795541 4:2701529-2701551 CCTGGTGGGATATACCAACAGGG - Intronic
969630279 4:8331996-8332018 TCTGGCTGGGAAAACACACATGG - Intergenic
975268945 4:72406217-72406239 GCTGGCAGTAAATACCAACAGGG + Intronic
976124282 4:81817005-81817027 TTTGACTGAAAATAACAACAAGG + Intronic
977078062 4:92483841-92483863 TGTGGCAGGAAACACCAACAGGG - Intronic
977676526 4:99754507-99754529 TCTGGTTGGAAATACCACAGGGG + Intergenic
978414547 4:108461598-108461620 TCAGGCTAGAAATAGCATCAGGG + Intergenic
981852422 4:149246686-149246708 TTTGTTTGGCAATACCAACAAGG - Intergenic
982102121 4:151978253-151978275 TCTGGCCAGAAATAACTACATGG + Intergenic
983826379 4:172267127-172267149 TATGGCTAAAAATACAAACATGG + Intronic
986945727 5:13016898-13016920 TGTGGCAGGATGTACCAACAAGG - Intergenic
992681084 5:79153797-79153819 CCTGGCTGGAGAAGCCAACATGG + Intronic
998051389 5:139038936-139038958 TCTGCCTGGTAGCACCAACATGG - Intronic
999544694 5:152614626-152614648 TCTGGCTGGAAACTACAACAGGG - Intergenic
1001224300 5:169930509-169930531 TCTGCCTGGAATTACTTACAAGG + Intronic
1002441837 5:179268383-179268405 CCTGGCAGGCAATGCCAACAAGG - Intronic
1005995395 6:30927946-30927968 TCTGGGTGGAAATGCAGACACGG - Intergenic
1010897524 6:81382745-81382767 TTTTGCTGAAAATACCAAGAGGG + Intergenic
1011314460 6:86016198-86016220 TCTGCTTGGAAATGCCAACATGG - Intergenic
1012570769 6:100724980-100725002 TCTGGCTGGAAGTACAGACATGG + Intronic
1013970847 6:116016572-116016594 TGTAGCTGCAGATACCAACATGG + Intronic
1015972697 6:138758691-138758713 TCTGGAAGAAAATACCAATAGGG + Intronic
1016860493 6:148714164-148714186 TCTGGCTAAAAATAGCAAGAGGG - Intergenic
1018618791 6:165711149-165711171 GCTGGCTGGAGAGAACAACAGGG + Intronic
1024979461 7:55145270-55145292 CAGGGCTGGAAACACCAACAGGG - Intronic
1026285917 7:68962688-68962710 TGTGGCTGGAAAGAACTACAGGG - Intergenic
1028790490 7:94848595-94848617 TCTGGTTGAAGATACAAACATGG + Intergenic
1029590957 7:101506754-101506776 TCTGGCTGGAAATCCCCGGATGG - Intronic
1029934021 7:104403676-104403698 TCTGGCTGGGAATCTCATCAAGG + Intronic
1031007954 7:116496013-116496035 TCTGGCCCAAAATGCCAACAGGG + Intronic
1032454425 7:132062305-132062327 TCTTGCTGGGCATGCCAACAAGG - Intergenic
1035843478 8:2837819-2837841 TCTGAATGCAAATATCAACAGGG - Intergenic
1036496158 8:9271803-9271825 CCTGGCTGGAAAGACCAGCCTGG - Intergenic
1036631679 8:10520264-10520286 ACTGGCTGAAAATGCCAACTTGG + Intergenic
1039978014 8:42383573-42383595 TCTGGCTGGGAATAGCACCAGGG + Intergenic
1046680399 8:117163407-117163429 TCTGGCTAGAAAAAAAAACAGGG - Exonic
1047185397 8:122628541-122628563 TCTGGCTTCAAATGCCATCAGGG - Intergenic
1048547647 8:135402618-135402640 TGTGGCTGCGAAGACCAACATGG - Intergenic
1050958763 9:11699958-11699980 TATGGCTTCAAATACCTACAGGG - Intergenic
1053037292 9:34836048-34836070 CCTGGCTGGAAAGAGAAACATGG + Intergenic
1055241434 9:74191104-74191126 TCTGGCAGGAAATACCATCATGG + Intergenic
1062137676 9:134938318-134938340 TGTGGCTGCAAATACAAACCTGG + Intergenic
1186510516 X:10126571-10126593 TGTGGCTGGAAATACAAACAGGG + Intronic
1189965089 X:46364306-46364328 TATTGCTAGAAATACCAAAATGG + Intergenic
1190651219 X:52570623-52570645 TCTGGCTTGAAATCCGAATAGGG - Intergenic
1194086231 X:89532193-89532215 TCTGACTGGGAATTTCAACATGG + Intergenic
1194512715 X:94815440-94815462 TTAGGCTGGTAATACCAACATGG + Intergenic
1194776712 X:97974064-97974086 TATGGCTGGAAATAAAAGCAGGG - Intergenic
1195753461 X:108178955-108178977 TACGGCTGGGAATAGCAACAAGG - Intronic
1198592347 X:138198301-138198323 TCTGACTGGAGGTTCCAACATGG + Intergenic
1199402867 X:147420118-147420140 TCTGGCTGGAAATGCAGGCAGGG + Intergenic
1200438891 Y:3188070-3188092 TCTGACTGGGAATTTCAACATGG + Intergenic
1200932874 Y:8712853-8712875 GCTGGCTGGAGTTACCCACAGGG - Intergenic
1201311120 Y:12598806-12598828 TCTGGCTGGGAATCCTAAAAGGG - Intergenic