ID: 1174042781

View in Genome Browser
Species Human (GRCh38)
Location 20:47711552-47711574
Sequence TTAAGGACATCAGCAACTTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 162}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174042780_1174042781 -9 Left 1174042780 20:47711538-47711560 CCAACAGGGCTTCTTTAAGGACA No data
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162
1174042773_1174042781 19 Left 1174042773 20:47711510-47711532 CCCACGACGGGCCATCTGGCTGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162
1174042776_1174042781 8 Left 1174042776 20:47711521-47711543 CCATCTGGCTGGAAATACCAACA 0: 1
1: 0
2: 2
3: 13
4: 219
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162
1174042772_1174042781 20 Left 1174042772 20:47711509-47711531 CCCCACGACGGGCCATCTGGCTG 0: 1
1: 0
2: 0
3: 5
4: 69
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162
1174042771_1174042781 21 Left 1174042771 20:47711508-47711530 CCCCCACGACGGGCCATCTGGCT 0: 1
1: 0
2: 1
3: 11
4: 249
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162
1174042775_1174042781 18 Left 1174042775 20:47711511-47711533 CCACGACGGGCCATCTGGCTGGA 0: 1
1: 0
2: 0
3: 3
4: 111
Right 1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG 0: 1
1: 0
2: 1
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174042781 Original CRISPR TTAAGGACATCAGCAACTTT CGG Intronic
901487729 1:9576912-9576934 TTAAGGATATCAGGAAGTTTGGG + Intronic
904655562 1:32043580-32043602 TTAAGAAAATCAACAGCTTTTGG - Exonic
905998430 1:42402355-42402377 TTAAGGACATATACAACATTGGG - Intronic
908540020 1:65113482-65113504 ACAATGACATCAGCAACTTTTGG - Intergenic
909677202 1:78251926-78251948 ATCAGGACATCAGAATCTTTAGG + Intergenic
910566817 1:88653066-88653088 TTAATGGCATCAGCAATTTTTGG - Intergenic
911716173 1:101135497-101135519 TTAAGAACATCTGGAAATTTAGG + Intergenic
914936281 1:151983440-151983462 TTTAGGTCATAAGCAACCTTTGG + Intronic
915057951 1:153153545-153153567 TTAGGCAAATCAGGAACTTTGGG - Intergenic
916311592 1:163404713-163404735 TCAAGGACATCAGGAATGTTGGG - Intergenic
916355288 1:163899172-163899194 TCAAGGACAACTGCAACATTTGG + Intergenic
918622760 1:186623992-186624014 TTGAGCACATTAGCAAATTTGGG + Intergenic
918709532 1:187709700-187709722 TTCAGGAGATCAGGAAGTTTTGG + Intergenic
924812064 1:247411740-247411762 GTAAGGACATCAGTCACTTGGGG - Intergenic
1062959385 10:1561360-1561382 TCAAGGAAATGAGCAAGTTTGGG - Intronic
1063630554 10:7729930-7729952 TTTCGGACATCACCAACTTTAGG + Exonic
1064280107 10:13943791-13943813 TTAAAGACATAAGCAATATTTGG - Intronic
1065191329 10:23211966-23211988 GTTAGGACTTCAGCATCTTTGGG - Intronic
1073755360 10:106575359-106575381 TCATGGACATCAGGATCTTTAGG + Exonic
1075978473 10:126717448-126717470 ATTAGGACATGAGCAACTCTGGG - Intergenic
1077482207 11:2821051-2821073 CTAAGGACATCAGCACTCTTCGG + Intronic
1081639532 11:44743217-44743239 TTAAGGCCATCACCAAGTTCAGG - Intronic
1084413503 11:69017236-69017258 ATTAGGACATCAACATCTTTAGG - Intergenic
1084631496 11:70354686-70354708 TAAATGATATCAGCAAGTTTTGG + Intronic
1086523653 11:87699962-87699984 TTAAGCTGATAAGCAACTTTAGG - Intergenic
1087841630 11:102926695-102926717 TGAAGGCCATCAGCCACTCTTGG - Intergenic
1088515741 11:110631597-110631619 TAAAGGGCATGAGCAACTTGGGG - Intronic
1089791617 11:120949154-120949176 TTAAGGATAAGAGGAACTTTGGG + Intronic
1093087096 12:14877995-14878017 TTAAGGACATCAAGAACTTAAGG + Intronic
1093773160 12:23040445-23040467 TAAAGGACATAAAGAACTTTGGG + Intergenic
1094788611 12:33882010-33882032 TTAAGCAGATAAGCAACTTTAGG + Intergenic
1095390738 12:41703292-41703314 TTAAGCGCATCAGTCACTTTAGG - Intergenic
1096527857 12:52223051-52223073 ATAAGGGCCTCAGCAACTTGGGG - Intergenic
1097771090 12:63586362-63586384 TTAAAGACACCAGCAATCTTTGG - Intronic
1099509933 12:83522038-83522060 TTCAGGACTTCAGTATCTTTGGG + Intergenic
1099624270 12:85048909-85048931 TTAAGGTAGTCAGCAAATTTTGG - Intronic
1099775470 12:87122316-87122338 TTAAGTATATCAGCAAATATTGG - Intergenic
1102594616 12:113982886-113982908 TTAAATAAATAAGCAACTTTGGG + Intergenic
1104169058 12:126262137-126262159 TTAAGGCCACCAGCTATTTTAGG - Intergenic
1104291904 12:127477503-127477525 TTATGCACATCAGAAACTGTAGG + Intergenic
1110407171 13:75163506-75163528 TGAAGAACATTAACAACTTTAGG - Intergenic
1112201904 13:97284474-97284496 ATAAGGACATCAGTTATTTTGGG + Intronic
1116231370 14:42222156-42222178 ATTAGGACATGAGCATCTTTAGG - Intergenic
1118047911 14:61992441-61992463 TTCAGGACAACAGCAACTCACGG - Intergenic
1118598382 14:67453568-67453590 CTCAGGCCATCAGCATCTTTTGG - Intronic
1118742970 14:68754490-68754512 TCAAGGTCATCACCAACATTTGG + Intergenic
1124094840 15:26639536-26639558 TCAAGGACTTGAGCATCTTTGGG + Intronic
1130162906 15:81419467-81419489 TTAAGGGCCTCAGCAATTTCAGG - Intergenic
1133759521 16:8787284-8787306 TTAATGTCATCAGTAAGTTTTGG - Intronic
1138368221 16:56501049-56501071 TTAAGAACAACTCCAACTTTGGG + Intronic
1138967581 16:62103814-62103836 TTATGGACATGAGCAACACTAGG - Intergenic
1140079619 16:71732901-71732923 TCAAGGTCAGCAGTAACTTTAGG + Exonic
1140948292 16:79791778-79791800 ATAAGGACACCAGCCACGTTGGG + Intergenic
1141432435 16:83977407-83977429 TTAAGAACATCAGGGACTCTGGG - Intronic
1142987778 17:3707354-3707376 TTAAGGACACCAGTACCTCTAGG - Intergenic
1149022303 17:51982725-51982747 TAAATTACATCATCAACTTTAGG + Intronic
1150295750 17:64006515-64006537 CTAAGAACCTCAGCAACTTTTGG + Intronic
1153222139 18:2871218-2871240 TTGGGGACATCATCAAATTTGGG + Intronic
1153505960 18:5798278-5798300 TGAAGGAAAACAGCAACATTTGG + Intergenic
1155659558 18:28231298-28231320 TTGAGGACATTTGAAACTTTAGG + Intergenic
1158164608 18:54525804-54525826 TCTAAGACATCAGCAATTTTGGG + Intergenic
1158214688 18:55087615-55087637 TTATTGACCTCAGCAACTTTGGG + Intergenic
1158801663 18:60918027-60918049 TTAAGTAAATCAGCATGTTTTGG - Intergenic
1160072997 18:75644873-75644895 ATAAGGACACCAGTAACATTAGG - Intergenic
1164655573 19:29918772-29918794 TTAAAGAAATCAGTAACTCTGGG + Intergenic
929483193 2:42332211-42332233 TTGAGGACATCAGTCACCTTTGG + Exonic
932763022 2:74452075-74452097 TTAAGGAGATAAGAAAGTTTTGG + Intergenic
933416225 2:81989873-81989895 TCAGGGACATCAGGAACATTTGG - Intergenic
933890856 2:86768488-86768510 TTACTGACATCAGCACCTGTGGG + Intronic
935648239 2:105359822-105359844 ACAAGGACATAAGCAACTTGAGG - Intronic
936394578 2:112112552-112112574 TTCAGGACAGCAGGACCTTTGGG - Intronic
936638849 2:114289757-114289779 TTAAGGATATCAGGAGCTTTAGG + Intergenic
937888735 2:126918754-126918776 TTGAGGACATCTGAAACTTGTGG - Intergenic
938865755 2:135418286-135418308 TGAAGGACATGAGCATCTGTGGG + Intronic
940655098 2:156478899-156478921 TCTAGGACATCAGGAACTTGGGG - Intronic
941325663 2:164110775-164110797 TTTAGGACCTCAGCCACTTTAGG - Intergenic
941891008 2:170581959-170581981 TTAAGGTGATCCTCAACTTTTGG - Intronic
942091401 2:172495025-172495047 TTAAGGACATCATCCACTCTTGG - Intronic
943993173 2:194723697-194723719 TTAGAGACATCAACAACTGTTGG + Intergenic
944914697 2:204346422-204346444 TTTAGGACAGCAGCAGTTTTTGG - Intergenic
945469838 2:210215137-210215159 TTAAAGACAGCAGCAACTTGTGG - Intronic
945745331 2:213713547-213713569 TTTTGGACATCAGCCACTTTAGG + Intronic
946343952 2:219093148-219093170 TTATGGAAATCAGCAGCTGTGGG - Intronic
947811806 2:233009496-233009518 TTAAACTCATCAGCAACTTGGGG + Intronic
1172991135 20:39037790-39037812 TTAAGGATTTCTGCCACTTTTGG + Intronic
1173092522 20:39986677-39986699 TTGAGGAGATCAGCAGCTCTCGG + Intergenic
1174042781 20:47711552-47711574 TTAAGGACATCAGCAACTTTCGG + Intronic
1174311286 20:49656860-49656882 TTCAGGACACCAACATCTTTTGG + Intronic
1174857186 20:54057601-54057623 GTTAGGACTTCAGCATCTTTGGG - Intronic
1177527344 21:22311721-22311743 ACAAGGACATCAGAAAATTTAGG + Intergenic
1181786603 22:25231666-25231688 ACAAGGACAGCAGCGACTTTGGG + Exonic
1181818769 22:25459478-25459500 ACAAGGACAGCAGCGACTTTGGG + Intergenic
1182409107 22:30167364-30167386 TTTAGGACATGAACATCTTTGGG + Intronic
949126909 3:456436-456458 TTAATAACAACAGCAACTATGGG + Intergenic
949881969 3:8668541-8668563 TCAAAGACATCATCAACTTAAGG + Intronic
951537051 3:23749909-23749931 CTAAGGACATCAGTCACTTCGGG + Intergenic
951886009 3:27525142-27525164 TTGAGGAAATCGGGAACTTTGGG + Intergenic
954409883 3:50365840-50365862 TTAAGGAAATCTGCAACGGTGGG + Exonic
954435211 3:50492311-50492333 TTTAGGACAACAGCAAGTTGCGG - Intronic
955096424 3:55802736-55802758 TTAAGGAAATCAGCAAGTTTAGG + Intronic
957556875 3:81773603-81773625 TTAAGCACATCAGTAAATTGGGG + Intergenic
960477593 3:118147767-118147789 AAAAGGACATGAGCAAATTTGGG - Intergenic
961713318 3:128843205-128843227 TTAAGGACAGCAGCACATTAGGG + Intergenic
961953443 3:130774280-130774302 ATAGGAACACCAGCAACTTTAGG - Intergenic
962093630 3:132271021-132271043 ATTAGGACATGAGCATCTTTGGG - Intronic
965985753 3:174751174-174751196 TTAAGCACAACAGCAAATTTTGG + Intronic
967430958 3:189384464-189384486 CTAAAAATATCAGCAACTTTGGG + Intergenic
970340442 4:15100771-15100793 TTGAGGACATAATAAACTTTTGG - Intergenic
970376927 4:15468113-15468135 GTTAGGACTTCAGCATCTTTGGG + Intergenic
974558873 4:63491380-63491402 TTTATGACATCAGCAACTAAAGG + Intergenic
978488258 4:109280902-109280924 TTAAGTATTTCAGCCACTTTGGG - Intronic
978752667 4:112269646-112269668 TTAAGCACAGCAAGAACTTTAGG - Exonic
979326841 4:119390143-119390165 TTAATAACATCAGTATCTTTAGG + Intergenic
981614866 4:146636029-146636051 TTAATCACATGAGAAACTTTTGG - Intergenic
983244712 4:165274814-165274836 TTAATAACATCAGTATCTTTAGG + Intronic
983504280 4:168535738-168535760 TTAAGAAACTCAGCAAGTTTAGG + Intronic
983607373 4:169604259-169604281 TTAAGGTCATTAGTATCTTTAGG + Intronic
983732733 4:171016440-171016462 TTAAAGACTCCATCAACTTTAGG + Intergenic
984830448 4:183967745-183967767 TTAAAAAGATCATCAACTTTGGG + Intronic
987506186 5:18776207-18776229 TTAAGGAAATCAGAAAATTTTGG - Intergenic
989416251 5:41180225-41180247 TTAATGAGATCAGCAACTGGAGG - Intronic
991292997 5:65050845-65050867 ATTAGGACCTCAACAACTTTTGG + Intergenic
991970886 5:72140765-72140787 TGAATGAAATCACCAACTTTAGG + Intronic
993313082 5:86362026-86362048 ATAAGGAAAACAGCAAGTTTTGG - Intergenic
993590708 5:89791502-89791524 TTTAGGGCATCAGAAACATTTGG - Intergenic
993703053 5:91141019-91141041 TTATGGACATAAGAAACATTAGG - Intronic
994328598 5:98479339-98479361 TTAAGGATCTCAGCAACAATGGG - Intergenic
1000840177 5:166208460-166208482 TTCAGGACATGAGTATCTTTCGG + Intergenic
1001926030 5:175637814-175637836 GTAAGGACTTCAACATCTTTTGG - Intergenic
1004145522 6:13062440-13062462 TTAAAGTCATAAGCAACTCTGGG - Intronic
1006285417 6:33089740-33089762 TTATGGATATCAGCAGCCTTTGG + Intergenic
1008652918 6:53581455-53581477 TAAAGGCCATCATAAACTTTGGG - Intronic
1009786560 6:68347890-68347912 TTGAGGAAATCACTAACTTTAGG - Intergenic
1014163767 6:118200592-118200614 TAAAGGAAAACAGCACCTTTAGG + Intronic
1016265812 6:142231909-142231931 TTAAGCTGATCAGCAACTTCAGG + Intergenic
1016529636 6:145043319-145043341 TCAAGGACATCAGAGACTTGAGG - Intergenic
1017888055 6:158616350-158616372 TTAAGCTGATAAGCAACTTTAGG - Intronic
1020880262 7:13752899-13752921 TTATTGACATCAGCACTTTTGGG - Intergenic
1020941744 7:14548091-14548113 TTAAGGACATGACCATCATTAGG - Intronic
1021249069 7:18302073-18302095 TTAAGGAAATCACCAACTGATGG - Intronic
1021755828 7:23851112-23851134 TTGAAGACATCAGCAAAATTGGG + Intergenic
1022930573 7:35108628-35108650 TTAAAGACACCAGCAATCTTTGG - Intergenic
1023351079 7:39320752-39320774 TTAACGACAACAACAATTTTTGG + Intronic
1025151058 7:56550097-56550119 TTAATGACATTAGGAAATTTCGG - Intergenic
1025737823 7:64168417-64168439 TTAATGACATCAAGAAATTTTGG + Intronic
1030284406 7:107810951-107810973 GTAAGGACATTAGTCACTTTGGG + Intergenic
1030295890 7:107926674-107926696 TTAAGGACACCTGCAAACTTTGG + Intronic
1031077869 7:117230132-117230154 TTTGGGACATCAACAATTTTAGG - Intergenic
1032807952 7:135376589-135376611 TTATGAACATCAGCAATCTTAGG - Intronic
1033113278 7:138602564-138602586 TAAAGGCCATCAGCAAATGTCGG - Intronic
1034469489 7:151247856-151247878 TTAAGGACATCAGCTTCTGGTGG + Intronic
1034656735 7:152735769-152735791 TTACAAACATCAACAACTTTGGG - Intergenic
1035283025 7:157789088-157789110 TCTAGGAGGTCAGCAACTTTAGG + Intronic
1035657288 8:1319728-1319750 GGCAGGACATCAGCAGCTTTGGG + Intergenic
1035854288 8:2957564-2957586 TTGAGGACATCCGAAAATTTAGG + Intronic
1037115408 8:15220186-15220208 TTAATGACCTCAAAAACTTTTGG - Intronic
1038150067 8:24935152-24935174 TTAAGGACAGCAGCATAGTTGGG - Intergenic
1041555846 8:59154553-59154575 TTAAGGCCATCATCCTCTTTAGG + Intergenic
1043279371 8:78444863-78444885 TTAAGAATATCAGCATTTTTCGG + Intergenic
1044438774 8:92198229-92198251 TTTAGGATAGCAGCTACTTTTGG + Intergenic
1044783136 8:95763904-95763926 TGAAGGCCATCAGAACCTTTTGG + Intergenic
1046189946 8:110780771-110780793 TTAAGGACCATAGCAAGTTTGGG - Intergenic
1047027080 8:120835931-120835953 TTAAGGACATCAGTCATATTGGG - Intergenic
1047290286 8:123523859-123523881 TTACTGTCATCATCAACTTTAGG - Intronic
1047463325 8:125089377-125089399 TTAAGGTCATCAGCTATTTTTGG - Intronic
1053531699 9:38888658-38888680 TTAAGGGCATGGGCATCTTTTGG - Intergenic
1054203923 9:62113086-62113108 TTAAGGGCATGGGCATCTTTTGG - Intergenic
1054766452 9:69046451-69046473 TTGAGGAAATCTGGAACTTTGGG + Exonic
1055674409 9:78640781-78640803 GTAGGGCCATGAGCAACTTTCGG + Intergenic
1056459184 9:86792714-86792736 CTAAGGACATCAGTCACTGTAGG - Intergenic
1057301597 9:93888968-93888990 TTAAGGACAACAGTAACAGTCGG + Intergenic
1058308686 9:103473804-103473826 ATTAGGACATGAGCATCTTTGGG + Intergenic
1058535621 9:105957117-105957139 TTAAAGACATCAAGAGCTTTAGG - Intergenic
1058770581 9:108227405-108227427 TTGGGGCCCTCAGCAACTTTGGG - Intergenic
1059264049 9:113009407-113009429 TTAAGCACATCTGCACCTTGAGG + Intergenic
1060252227 9:121995533-121995555 TTTGGGACTTCAGCAATTTTGGG + Intronic
1060611388 9:124968673-124968695 TTGAGGAAATCGGGAACTTTGGG - Intronic
1188643115 X:32530957-32530979 ATAAGGACATAGGCAGCTTTTGG - Intronic
1193403892 X:81079278-81079300 TTAAGGATATTTTCAACTTTTGG - Intergenic
1199122402 X:144071111-144071133 TTAAGCTGATAAGCAACTTTGGG - Intergenic