ID: 1174044595

View in Genome Browser
Species Human (GRCh38)
Location 20:47724510-47724532
Sequence CCTTCTAGGGAGCGGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174044595_1174044602 1 Left 1174044595 20:47724510-47724532 CCAGCCATCCGCTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 225
1174044595_1174044605 23 Left 1174044595 20:47724510-47724532 CCAGCCATCCGCTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 110
1174044595_1174044603 7 Left 1174044595 20:47724510-47724532 CCAGCCATCCGCTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174044595 Original CRISPR CCTTCTAGGGAGCGGATGGC TGG (reversed) Intronic
903767982 1:25747026-25747048 CCTTGCAGGGAGGGGATGGATGG - Intronic
906079116 1:43071924-43071946 CCTTCTGGGGATGGGATGACAGG + Intergenic
906545738 1:46618024-46618046 CCTGCTTGGGAGTGGAGGGCGGG + Intergenic
908416047 1:63914385-63914407 CTTCCTAGGGAGAGGAAGGCAGG + Intronic
916290068 1:163155833-163155855 CTTTCTAGAGAGTGGATGCCTGG - Intronic
917490283 1:175492930-175492952 AATTCTAGGTAGTGGATGGCTGG + Intronic
919763224 1:201111278-201111300 CCTTCTAGGGAACAGCTGGTAGG + Intronic
920868970 1:209777344-209777366 CCTTACAGGGAGCAGATAGCAGG + Exonic
1063364328 10:5480662-5480684 CCCTCCAGGGAGGGGAAGGCAGG - Intergenic
1068892630 10:62163606-62163628 CCTTCTAGGCAGATGATGCCTGG + Intergenic
1069722202 10:70556968-70556990 CTTTCTAGTGAGTGGATGGAGGG + Intronic
1071410978 10:85394979-85395001 CTTTCTAGGGAGAGAAGGGCAGG - Intergenic
1078604766 11:12765292-12765314 CCTTTTGGGAAGCAGATGGCAGG + Intronic
1083933287 11:65857607-65857629 CCGTCTCGGGAGCAGGTGGCAGG - Intronic
1084691922 11:70732565-70732587 GCTTCTAGGGAGGGGAGGGTCGG - Intronic
1084740688 11:71137630-71137652 CCTTCCAGGGAGTGGGTGGCGGG - Intronic
1090109623 11:123892303-123892325 CCTTAGAGAGAGCAGATGGCTGG + Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106546091 13:30732202-30732224 CCTTCTAAAGCGCGAATGGCTGG + Intronic
1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG + Exonic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1118600637 14:67469605-67469627 CCTTCCAGGAAGAGGATGGAGGG - Intronic
1119263232 14:73250504-73250526 CTTTCTAGGGAGCAGAAGGTCGG - Intronic
1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG + Intronic
1121010563 14:90517770-90517792 CCTTTGAGAGAGCGGGTGGCAGG - Intergenic
1122861196 14:104583062-104583084 CCAGTTAGGGAGGGGATGGCAGG + Intronic
1122881340 14:104691803-104691825 CCTCCTAGGGTGAGGCTGGCAGG - Intronic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1132655023 16:1038208-1038230 CCTTCCAGGGAGCAGAGGGCTGG - Intergenic
1132884539 16:2176823-2176845 CCATCTAGGGTGGGGATGGAGGG - Exonic
1133322590 16:4923480-4923502 CCTTCCAGGTCGCTGATGGCTGG - Intronic
1136034654 16:27530044-27530066 CCAGCAAGGGAGCGAATGGCAGG + Intronic
1137669763 16:50272245-50272267 CCTTCTAGGGCCCGGATCCCTGG + Intronic
1139325050 16:66146029-66146051 CCCTCTTGGAAGGGGATGGCTGG + Intergenic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG + Intergenic
1146379027 17:32314882-32314904 CATGCTAGGAAGCAGATGGCAGG - Intronic
1151539571 17:74758224-74758246 CAGTCCAGGGAGCGGATGGCGGG - Intronic
1158592578 18:58790107-58790129 CCTTCTTGGGAGGGGAGAGCTGG + Intergenic
1161079811 19:2305182-2305204 CCTTCTGGGGCGTGGAAGGCAGG + Intronic
1161894560 19:7070349-7070371 CATTTTAGGGACCAGATGGCTGG + Intronic
1162871746 19:13591637-13591659 CCAGCTAGGGATCGGATGGGTGG - Intronic
1166422969 19:42652826-42652848 CCTCCTAGGGTGCAGAGGGCAGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925959637 2:9003399-9003421 CCTTCCAGGGAGCGGCGGGTAGG + Intronic
930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG + Intronic
932594553 2:73086065-73086087 CCTTGCAGGGAGGGGAAGGCTGG - Intronic
942584927 2:177465628-177465650 CCTTGTAGGGAGCTGATGCCTGG - Intronic
943276876 2:185878540-185878562 TCTTCTAGGCAGCAGATGGTTGG - Intergenic
946083789 2:217150723-217150745 CTTTCTATGGAGCGGTAGGCTGG + Intergenic
947466110 2:230347881-230347903 TCTGCTAGGGTGCTGATGGCAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174399153 20:50266745-50266767 CCTTCTAGGGAGGGGTTGTGTGG - Intergenic
1175639145 20:60612486-60612508 CTTTCTAGGGATTGGATGGCTGG - Intergenic
1179180255 21:39038397-39038419 CCTTCTAGGCTGGGCATGGCAGG - Intergenic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1183355076 22:37354219-37354241 CCCTCGAGGGAGAGGCTGGCAGG + Intergenic
1183830810 22:40417550-40417572 CCTTGTAGGGGGCGGGGGGCGGG + Intronic
1184836994 22:47029644-47029666 GCTTCTGGGGCGGGGATGGCAGG + Intronic
1185004491 22:48267774-48267796 CGTTCTAGGAAAAGGATGGCAGG - Intergenic
949797020 3:7862577-7862599 CCTTAGAGGGAGCGACTGGCTGG + Intergenic
954894372 3:53963450-53963472 CCTTCAAGGGGGCGGGTGTCAGG + Intergenic
968947691 4:3674286-3674308 CATTCTAGGGAGGAGATAGCCGG - Intergenic
969118572 4:4889902-4889924 CCCTTGAGTGAGCGGATGGCAGG + Intergenic
972801801 4:42483545-42483567 CCTTCTAGGGACCTGGTGCCTGG + Intronic
975573943 4:75844510-75844532 CCTTCTAGGAAGTGGATTCCTGG + Intergenic
977955787 4:103024072-103024094 GCTGCTAGGGAGCTCATGGCAGG - Intronic
979503439 4:121466675-121466697 CTTTCTAGGGAGAGCAAGGCCGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG + Intergenic
984950691 4:185005354-185005376 GCTTCTAAGGAGAGGCTGGCTGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
994353373 5:98770302-98770324 CCTTCTTGGGAGCGAGTGGCTGG + Intronic
994511877 5:100714362-100714384 CCTTTTAGAGGGCGGAGGGCAGG - Intergenic
1001080723 5:168665412-168665434 CCTTCTTGGAAGCGGAAGGCTGG - Intronic
1003138930 6:3455986-3456008 CCTTGTCCGGAGGGGATGGCAGG + Exonic
1004924591 6:20404076-20404098 TTTTCTAGGGGGCGGATGGATGG + Intronic
1005883258 6:30075633-30075655 CCTTCGAGCGCGCAGATGGCGGG + Exonic
1007743734 6:44029490-44029512 GGTTCTAGGGAGGGGAGGGCAGG + Intergenic
1023803325 7:43853606-43853628 CCTTCTAGGTAGAGGAAGGTTGG - Intergenic
1024559916 7:50634619-50634641 TCTTGTAGGCAGCAGATGGCTGG - Intronic
1029651056 7:101892038-101892060 CCTTTTAGGGAGTGGATTTCTGG - Intronic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1032080607 7:128856693-128856715 CCTTCTGGGGAGGGGAAGGATGG + Intronic
1034235984 7:149569897-149569919 CCCGCTAGGGAGTGGCTGGCGGG - Intergenic
1034585441 7:152087526-152087548 CTTTGTAGGGAGCAGATGGGTGG + Intronic
1053476298 9:38384413-38384435 CATTCTAGGGATCAGAAGGCGGG - Intergenic
1058975915 9:110125439-110125461 CCTTTTAGGGAGCAGAGGGAGGG + Intronic
1061306647 9:129736376-129736398 CCTGCTGGGGAGCGGCTGCCTGG - Intergenic
1062049442 9:134439473-134439495 GCTTCCAGGGTGCGGAGGGCCGG - Intronic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062737729 9:138147598-138147620 CCGTCAAGGCAGGGGATGGCGGG + Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1197721812 X:129750460-129750482 GCTTCTAGGGAGCACTTGGCAGG + Exonic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1198942399 X:141971002-141971024 CCTTCTAGGGATGGGATAGATGG - Intergenic
1199429233 X:147740309-147740331 CATTCAAGGGTGAGGATGGCAGG - Intergenic
1201145392 Y:11062320-11062342 CCTGCTGGGGAGTGGGTGGCAGG - Intergenic