ID: 1174044602

View in Genome Browser
Species Human (GRCh38)
Location 20:47724534-47724556
Sequence TCTTGCAGCTCCTGCAAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174044593_1174044602 25 Left 1174044593 20:47724486-47724508 CCTGTGCCTAATTAAATGCTGGC 0: 1
1: 0
2: 0
3: 5
4: 109
Right 1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 225
1174044598_1174044602 -3 Left 1174044598 20:47724514-47724536 CCATCCGCTCCCTAGAAGGGTCT 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 225
1174044594_1174044602 19 Left 1174044594 20:47724492-47724514 CCTAATTAAATGCTGGCTCCAGC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 225
1174044599_1174044602 -7 Left 1174044599 20:47724518-47724540 CCGCTCCCTAGAAGGGTCTTGCA 0: 1
1: 0
2: 1
3: 17
4: 135
Right 1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 225
1174044595_1174044602 1 Left 1174044595 20:47724510-47724532 CCAGCCATCCGCTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG 0: 1
1: 0
2: 0
3: 19
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174044602 Original CRISPR TCTTGCAGCTCCTGCAAATG AGG Intronic
902601981 1:17546203-17546225 TCTTCCAGCCCCTGCATCTGTGG + Intronic
902673701 1:17993786-17993808 TCTTTAAGCTCCTGCAACAGTGG + Intergenic
903211634 1:21822375-21822397 TCTTCAGGCTCCTGCAGATGGGG + Exonic
905061720 1:35145444-35145466 TCTGGCAGCTCCTGCAAAACTGG + Intergenic
906438582 1:45819593-45819615 ATTTGCAGCTACTGTAAATGGGG - Intronic
906910852 1:49947932-49947954 TATTGCAGCTATTGCAAAAGGGG - Intronic
909098669 1:71322632-71322654 TCTTGCAGCTATTGTAAAAGAGG - Intergenic
910125482 1:83837434-83837456 TCTTGCAGGTGATGCTAATGGGG - Intergenic
911448677 1:98035364-98035386 TCTTACAGCCACTGCAAATACGG + Intergenic
915670096 1:157481662-157481684 TCTTTAAGCTCATGCCAATGAGG - Intergenic
918781872 1:188709793-188709815 TCTTGCAGCTTGTTCAATTGTGG - Intergenic
918972499 1:191437676-191437698 TCTTGCAGCTATTGTAAAAGTGG - Intergenic
922160352 1:223074918-223074940 TCTTGCCGCTCCTGCAGCTGTGG - Intergenic
923272073 1:232364899-232364921 TCTGGCAGTTCCTCAAAATGAGG + Intergenic
1064830892 10:19464965-19464987 TTTTGCAGCTCTTGTAAAAGTGG + Intronic
1065772638 10:29091858-29091880 TCCTGCAACACTTGCAAATGTGG + Intergenic
1066425485 10:35304126-35304148 CTTTGCACCTCCTGCACATGGGG + Intronic
1067134408 10:43595308-43595330 TCTGGCAGCTCCTGCAAGACTGG + Intergenic
1067712183 10:48658087-48658109 TTTGGAAGCTCCTGGAAATGAGG + Intergenic
1067784832 10:49237907-49237929 TCTTGAAGCTCCTATCAATGTGG - Intergenic
1068114837 10:52725363-52725385 TTTTTCAGCTCCTGTAAAAGGGG - Intergenic
1068920273 10:62475965-62475987 TATTGAATCTCCTGCATATGAGG + Intronic
1068924589 10:62522444-62522466 TTTTGCAGCTCTTGTAAAAGAGG + Intronic
1069242363 10:66158910-66158932 TTTTGCAGCTACTGTAAAAGGGG + Intronic
1069286249 10:66719538-66719560 TGTAGCAGCTTCTGCACATGGGG + Intronic
1069719821 10:70542193-70542215 TCTTGCAGCCTTTGCATATGCGG + Intronic
1070840366 10:79482798-79482820 TCTAGTAGCTCCTGCAAGTGGGG - Intergenic
1071143825 10:82543767-82543789 TCGTTCAGCTCCTGCACATCAGG + Intronic
1071965489 10:90847677-90847699 TATTACAGCTCTTGCAAATAAGG + Intronic
1072542870 10:96411788-96411810 TCCTGCAGCTCCAAAAAATGTGG - Intronic
1072917908 10:99551078-99551100 TCTTGTAGCTCCTACAGAAGAGG - Intergenic
1074137874 10:110643928-110643950 TCTCGCAGCTCCTGCCAAGCCGG - Intergenic
1075026795 10:118991095-118991117 TTGTGCAGCTCCTGGAAATCTGG - Intergenic
1076078335 10:127555371-127555393 TCTTGGAGCATCTGCAAATGCGG + Intergenic
1077449690 11:2631746-2631768 TCTTGCAGCTCCATCAGCTGAGG + Intronic
1078842109 11:15087443-15087465 TTTTGCAGCTGTTGCAAAAGTGG + Intergenic
1079494013 11:21020676-21020698 TCTTCCAGCTACTGCAGATGAGG - Intronic
1079634351 11:22716885-22716907 TTTTGCAGCTACTGTAAAAGGGG - Intronic
1079926344 11:26496393-26496415 ATCTGCAGATCCTGCAAATGTGG - Intronic
1080914283 11:36639565-36639587 TCATGCAGTTTCTGCACATGTGG - Intronic
1081212254 11:40350841-40350863 ACTTGTAGCTAGTGCAAATGGGG + Intronic
1087553733 11:99687995-99688017 TCTTACAGCTCCTGGAAATCTGG - Intronic
1088179860 11:107097006-107097028 TTTTGCAGCTACTGTAAAAGAGG - Intergenic
1088501044 11:110482601-110482623 TTTTGCAGCTGTTGCAAAAGAGG + Intergenic
1089403072 11:118176009-118176031 TTTTGGAGTTGCTGCAAATGCGG - Intronic
1089825882 11:121276843-121276865 TCTTGCAGCTATTGTAAAAGGGG + Intergenic
1089985472 11:122808825-122808847 TCTTCCAGCACTTACAAATGAGG - Intronic
1090229100 11:125089060-125089082 TCAGGCAGCTGCTGCAGATGTGG + Exonic
1090458390 11:126868906-126868928 TCTTGCCCCTCCAGCAAGTGAGG - Intronic
1091134632 11:133177728-133177750 TCTAGCTGCTCGAGCAAATGTGG + Intronic
1092264276 12:6969373-6969395 TGTTACAGCTCTTGCAGATGTGG + Intronic
1092438065 12:8469176-8469198 TTTTGCAGCTACTGTAAAAGGGG - Intronic
1093030523 12:14284515-14284537 TCATGCAGCTGTTGCAGATGGGG + Intergenic
1093758822 12:22882124-22882146 TCTCACAGCTTCTGCAAATCAGG - Intergenic
1094059747 12:26301127-26301149 TCTTGCAGCTTCAGGAGATGAGG - Intergenic
1094120075 12:26963330-26963352 GCTTGCAGTTCCTGAAAAAGAGG - Exonic
1094384486 12:29879328-29879350 TTTTGCAGCTCCTTCATAGGTGG - Intergenic
1095058644 12:37653141-37653163 ACTTGCAGATTCTGCAAAAGGGG - Intergenic
1095560477 12:43558962-43558984 TTTTGCAGCTATTGTAAATGGGG + Intergenic
1096531427 12:52244975-52244997 TCTTCGAGCTCCTGCAGCTGGGG + Intronic
1096599436 12:52718845-52718867 TCTTGTAGGCCCTGCAAGTGAGG - Intergenic
1097201725 12:57284563-57284585 TCTTGCAACTCCTGGAAGGGTGG - Intronic
1097660107 12:62420800-62420822 TTTTGCAGCTATTGTAAATGGGG - Intergenic
1099330808 12:81284240-81284262 TCTTGCAGCTCCAGCAAAAACGG - Exonic
1099621690 12:85009403-85009425 TCTTGCAAGTCTTGCAAATAGGG + Intergenic
1103984611 12:124759039-124759061 TCATTCAGCACTTGCAAATGAGG + Intergenic
1104339703 12:127936793-127936815 TATTGCATCTCCTGCCAAAGAGG - Intergenic
1105961162 13:25341177-25341199 TATAGCAGCTCCTCCAAATGAGG + Exonic
1108989431 13:56636326-56636348 TTTTTTAGCTCCTGCATATGAGG - Intergenic
1110990465 13:82037806-82037828 TCTTGCAGCAGCTGCTAATTGGG - Intergenic
1111309832 13:86470394-86470416 TCCTGCAGTGCCTACAAATGTGG + Intergenic
1114161248 14:20170119-20170141 TGTTGCAGATCCTGCCATTGTGG - Intergenic
1114448768 14:22810574-22810596 TCTTGGAGCACCCTCAAATGTGG - Intronic
1114573759 14:23694338-23694360 TCTGGCAGCTCCTGCAAAACTGG - Intergenic
1115047315 14:29012082-29012104 TCTTGCAATTCCTGAACATGGGG - Intergenic
1115338253 14:32263640-32263662 TCTTGCAGCTCCATCACCTGAGG - Intergenic
1118900088 14:69979279-69979301 TCTTGGAGCACCTGCATTTGGGG - Intronic
1121723603 14:96129974-96129996 TGGCACAGCTCCTGCAAATGTGG - Intergenic
1122428988 14:101628094-101628116 TCTTGCAGCTCCTGGGTCTGGGG + Intergenic
1122628370 14:103096004-103096026 CCTTCCAGCCCCTGCAAATAAGG - Intergenic
1123145167 14:106122691-106122713 TCTTGCAGGTCCAGCCCATGAGG + Intergenic
1202921030 14_KI270723v1_random:30703-30725 TCCCTCAGCTCCTGCACATGGGG + Intergenic
1123398515 15:19961096-19961118 TCTTGTAGCTCCTGGCCATGGGG + Intergenic
1125372524 15:38993742-38993764 TCTTGCTTCTCTGGCAAATGGGG - Intergenic
1126275408 15:46873232-46873254 TGTTGCAGCTGTTGCTAATGAGG + Intergenic
1127735113 15:61832216-61832238 TCAGGGAGCTCCTACAAATGAGG + Intergenic
1128471602 15:67958514-67958536 TCTTGGAGCACCTGCCCATGTGG + Intergenic
1128744753 15:70105781-70105803 TCTGGCAGCTCCTCCAAGTGGGG + Intergenic
1131169187 15:90164690-90164712 TGGGGCAGCTCCTCCAAATGAGG + Intronic
1131177498 15:90219369-90219391 TCATGCATCACCTTCAAATGGGG - Intronic
1131389156 15:92033264-92033286 TGTTCCAGCACCTGCAAGTGTGG + Intronic
1132412543 15:101594300-101594322 TTTTGCAGCTACTGTAAAAGGGG + Intergenic
1133575183 16:7082077-7082099 TCTCCCAGATCCTGCAAATTGGG - Intronic
1135568227 16:23528482-23528504 TCTGGCAGCTCCTGAACATTTGG + Intronic
1135678593 16:24438240-24438262 CCTTGCAGCTCTTGCAAATCTGG - Intergenic
1136735625 16:32463942-32463964 TTTTGCAGCTATTGCAAAAGGGG + Intergenic
1137527062 16:49245735-49245757 TCTTGAAGGTGCTGCACATGTGG - Intergenic
1138898879 16:61244370-61244392 ACCTGCAGCTTCGGCAAATGGGG + Intergenic
1142194724 16:88734100-88734122 TCTTCCAGCCCCAGGAAATGAGG - Intronic
1203017452 16_KI270728v1_random:365628-365650 TTTTGCAGCTATTGCAAAAGGGG - Intergenic
1203035787 16_KI270728v1_random:638786-638808 TTTTGCAGCTATTGCAAAAGGGG - Intergenic
1144121486 17:12158132-12158154 TTTTTAAGCTCCTGCATATGAGG + Intergenic
1146108798 17:30068380-30068402 TTTTGTAGCTACTGTAAATGGGG - Intronic
1149606561 17:57929100-57929122 TCTTGGAGCATCTGGAAATGAGG - Intronic
1150217993 17:63480893-63480915 TCTTGCAGCCCCAGGACATGTGG + Intergenic
1151033438 17:70770435-70770457 TCTTTCTGCTACTGCACATGAGG + Intergenic
1151882867 17:76905351-76905373 TTTCTCAGCTCCTGCACATGAGG - Intronic
1153079564 18:1206532-1206554 TTTTGCAGCTTCTGTAAAAGGGG + Intergenic
1154471740 18:14709853-14709875 TGTTGCAGATCCTGCCATTGTGG + Intergenic
1155622054 18:27790546-27790568 ACCTGCAGTTCCTACAAATGTGG + Intergenic
1159880042 18:73850383-73850405 TCTTGCAGCACCTGCTTCTGGGG - Intergenic
1162943853 19:14030892-14030914 TCCAGCAGCTGCTGCAAGTGGGG + Exonic
1163953495 19:20612915-20612937 TCTGGCAGCTCCTGCAAAACTGG - Intronic
1164675432 19:30097366-30097388 TCTTCGAGCTCCGGCACATGGGG + Intergenic
925338128 2:3113809-3113831 TCATGAAGCCCCTGGAAATGCGG + Intergenic
926158298 2:10470214-10470236 TCTTTCAGATCCTGCTAAAGTGG - Intergenic
926441212 2:12890480-12890502 ACTTGCAGCTCCACCAACTGAGG - Intergenic
927199159 2:20567834-20567856 TCTTGAAGCTGCTGCAAACTTGG - Intronic
928297887 2:30101192-30101214 TTTTGCAGCTACTGTAAAAGGGG + Intergenic
932859186 2:75271190-75271212 TCTTGTAGCTATTGTAAATGGGG + Intergenic
933627311 2:84615802-84615824 TCTTGCAGCTATTGTAAAAGGGG + Intronic
934574704 2:95392549-95392571 TCCTGCTGCCCCTGCAGATGTGG + Intergenic
935532155 2:104247654-104247676 TCCTGCAGATCCTGTAATTGTGG - Intergenic
938078915 2:128358911-128358933 TCTGACAGCTCCTGCCTATGCGG + Intergenic
938968766 2:136412168-136412190 TCTAGCAGCTCAGGCAAATGTGG + Intergenic
939911595 2:147989954-147989976 CCTTACAGCTCCAGCAGATGGGG + Intronic
941157187 2:161993606-161993628 TCTCTCAGCACCTGCAAAAGAGG - Intronic
941702474 2:168618619-168618641 TTTTGCAGCTACTGTAAAAGGGG - Intronic
943977828 2:194506496-194506518 TTTTGCAGCTACTACAAAAGAGG - Intergenic
944884745 2:204050881-204050903 TTTTGCAGCTGTTTCAAATGGGG + Intergenic
945382253 2:209154915-209154937 TCTGGCATCTGCTGAAAATGAGG + Intergenic
946004999 2:216517370-216517392 TCTTGAAGACCCTGAAAATGAGG - Intronic
946135939 2:217646922-217646944 TCCTGCTGCTCCTACAACTGGGG + Intronic
946965471 2:225032612-225032634 TTTTGAAGATACTGCAAATGTGG - Intronic
1169450873 20:5709831-5709853 TCTTGCAGCTCAGCCACATGAGG - Intergenic
1170510897 20:17075787-17075809 TATTGCAGCTCCTGGGATTGGGG - Intergenic
1171160114 20:22914290-22914312 TCTTGCAGCTATTGTAAAAGGGG + Intergenic
1174044602 20:47724534-47724556 TCTTGCAGCTCCTGCAAATGAGG + Intronic
1175521125 20:59603636-59603658 CCTTCCAGCACCTGCAAAGGGGG + Intronic
1178072322 21:28982358-28982380 TCCTGCAGCACCTACAAAGGGGG + Exonic
1181640730 22:24196646-24196668 TCTTGTTAGTCCTGCAAATGCGG - Intergenic
1183599169 22:38830142-38830164 TCCTGCAACTCCTCAAAATGAGG - Intronic
1184729659 22:46365595-46365617 CCTTGCAGCTCCTGGGCATGAGG + Exonic
951444012 3:22755879-22755901 TCTTGCAGCTATTGTAAAAGGGG - Intergenic
952105148 3:30060871-30060893 TCTTGCAGCAGCTGGAAATCTGG - Intergenic
952870818 3:37899441-37899463 GTTGGCAGCTCCTGCACATGGGG - Intronic
955799795 3:62674086-62674108 TTTTCCAGCTTCTGCAATTGTGG + Intronic
958667757 3:97162053-97162075 AATTGCAGCTGCTGCAGATGTGG - Intronic
959758397 3:109927036-109927058 TCTTGCAGATGCTGAAACTGAGG + Intergenic
960095490 3:113685923-113685945 GCTTGCAGCTCCAGCAGAAGAGG - Intronic
963832393 3:150022424-150022446 GCTTGCAGCTCCTGCTCATATGG + Intronic
965228267 3:166019728-166019750 TTTTGCAGCTCTTGTAAAAGAGG - Intergenic
966020659 3:175204833-175204855 TTTTGCAGCTCTTGTAAAAGGGG - Intronic
966994777 3:185268842-185268864 TCTGGGAGCTCCTGGAACTGGGG - Intronic
969646877 4:8435795-8435817 TCTGGCGGCTCCTGCAAAACTGG - Intronic
971335294 4:25717799-25717821 TCTTGCAGCTGAGGAAAATGAGG - Intergenic
973253286 4:48083299-48083321 TGTTGCATGTCCTGCAAGTGGGG + Intronic
973649860 4:52987886-52987908 ACTTGCAGTTCCTCCACATGGGG - Intronic
976155375 4:82138739-82138761 TCTCGCAGCTCTTGCAGCTGAGG + Intergenic
976647897 4:87404383-87404405 TTTTTGAGCTCCTGCAAATGAGG + Intergenic
977166151 4:93700699-93700721 TCTTGCTGCTTAAGCAAATGAGG + Intronic
977813484 4:101386138-101386160 TTTTGCAGCTACTGTAAAAGGGG + Intergenic
978338063 4:107690897-107690919 TCTTGCAGCTCTCGGAAAAGGGG - Intronic
979169417 4:117582032-117582054 TCTTCCAGCTCCTGTCACTGTGG + Intergenic
986333582 5:6736112-6736134 TCATGAAGCACCTGCAAATCAGG - Intronic
986552235 5:8970363-8970385 ACTTGTAGCTACTGTAAATGGGG + Intergenic
987576422 5:19734006-19734028 TGCTGCAGGTCCGGCAAATGGGG + Intronic
989689642 5:44125718-44125740 TTTTGCAGCTATTGCAAATGGGG - Intergenic
990815683 5:59782584-59782606 TCTTGCAACTCCAGAAAAGGTGG - Intronic
993320214 5:86461539-86461561 TCTGGCGGCTCCTGCAAAACAGG - Intergenic
994754823 5:103780494-103780516 TGTTGAAGCTGCTGCAAATTTGG + Intergenic
995138692 5:108708138-108708160 GCTTGCAGCTCATACAAAGGAGG - Intergenic
995530210 5:113085006-113085028 CCTTGCAGCTCCTGCATAGAAGG + Intronic
995975473 5:118030664-118030686 TTTTGTAGCTACTGTAAATGGGG - Intergenic
998635001 5:143943605-143943627 TCTTGCAGCTATTGTAAAAGGGG + Intergenic
999839268 5:155407230-155407252 TTTTGCAGCTATTGTAAATGGGG - Intergenic
1000768138 5:165317587-165317609 ACTTGCAGGACATGCAAATGAGG - Intergenic
1003201316 6:3963874-3963896 TCATGGAACTCCTGGAAATGGGG + Intergenic
1004265435 6:14144952-14144974 TCTTTCAGTTCCTGGAATTGGGG + Intergenic
1004503673 6:16230342-16230364 TCTGGTAGCTCCTGCAAAACTGG + Intergenic
1007664645 6:43507096-43507118 TCTGGCAGCTCCTGGCAGTGTGG - Exonic
1007973875 6:46080511-46080533 TCTTGGAGTTACTGCCAATGAGG - Intergenic
1007975849 6:46100473-46100495 TCCTGCAGCTTGTGCCAATGCGG - Intergenic
1008027876 6:46658787-46658809 TCTTGATGCTTCTCCAAATGGGG - Intronic
1009807931 6:68626652-68626674 TCTTGCTGCCTCTTCAAATGGGG - Intergenic
1009817160 6:68751057-68751079 TACTGCTGCTTCTGCAAATGTGG + Intronic
1010304722 6:74306061-74306083 TCTGGCAGCTCCTATAAAGGAGG + Intergenic
1011328727 6:86179921-86179943 TCTTGCAGCTATTGTAAAAGGGG + Intergenic
1013383055 6:109596460-109596482 TCTTCTAGGTCCTCCAAATGAGG - Intronic
1014566891 6:122960309-122960331 TTTTGCAGCTATTGTAAATGAGG - Intergenic
1015486211 6:133772887-133772909 TCCTGCAGCTGGTCCAAATGTGG - Intergenic
1015565931 6:134571257-134571279 TTTTGCAGCTATTGTAAATGGGG - Intergenic
1015643927 6:135365564-135365586 TTTTGCAGCTACTGTAAAGGGGG + Intronic
1017278184 6:152594306-152594328 TCTGGCTGTTCCTGCACATGAGG - Intronic
1018009820 6:159659999-159660021 TTTTGCAGCTACTGTAAAAGGGG - Intergenic
1019000940 6:168751103-168751125 TGTTGCAGCTGTTGCAAAAGGGG + Intergenic
1021200951 7:17728197-17728219 TCTGGGAGCTGCTACAAATGAGG + Intergenic
1024154150 7:46603223-46603245 CCTTGCAGAGGCTGCAAATGTGG - Intergenic
1024685658 7:51742088-51742110 TCTTACAGCTTCTGCAGATTAGG - Intergenic
1025163199 7:56684397-56684419 TTTTGCAGATCCAGTAAATGGGG - Intergenic
1025773258 7:64533405-64533427 TTTTGCAGCTACTGTAAAAGGGG - Intronic
1026287213 7:68973795-68973817 TTTTACAGCTCCTGCAAAATAGG - Intergenic
1031300963 7:120060351-120060373 TCTGGCAGTTCCTGCAAAAGTGG + Intergenic
1033109896 7:138564452-138564474 TCTGGCAGTTCCTGCAAAACTGG + Intronic
1033363869 7:140656797-140656819 TCTGGCAGCTCCTGCAAAACTGG - Intronic
1033623676 7:143087160-143087182 TTTTGCAGCTACTGTAAAAGGGG - Intergenic
1033652701 7:143354599-143354621 TCTCAGAGCTCCTGGAAATGAGG + Exonic
1033930266 7:146510733-146510755 TCTTGTAGCTATTGTAAATGGGG + Intronic
1034473705 7:151270511-151270533 TCTTGCAGCACCTACCAAAGAGG - Intronic
1036137274 8:6173818-6173840 TGTTACAGCTCCTGCAGAGGAGG - Intergenic
1037952991 8:23030824-23030846 GATTGCATCTCCTGCAAATATGG - Exonic
1038009520 8:23463735-23463757 TCCTGCAGCGCTTGGAAATGGGG + Intergenic
1038382419 8:27108838-27108860 CCTGCCTGCTCCTGCAAATGAGG - Intergenic
1041030654 8:53732751-53732773 TCTGGCGGCTCCTGCAAAACTGG - Intronic
1041053009 8:53955976-53955998 TCATGGAGCTCCTGGAGATGTGG + Intronic
1041167457 8:55103270-55103292 TCTTGCAGCTCGGGCAAATCTGG + Exonic
1042204181 8:66311707-66311729 TGTGACAGCTGCTGCAAATGGGG + Intergenic
1043692402 8:83171092-83171114 TCTTTCATCTCATGTAAATGTGG + Intergenic
1044529871 8:93294797-93294819 CCATGCTGCTCCTGCAAATAAGG - Intergenic
1045848601 8:106666353-106666375 AATTGCAGCTAATGCAAATGAGG + Intronic
1049770034 8:144375541-144375563 TTTTCCAGCGCCTGCAGATGAGG - Intronic
1050999737 9:12267147-12267169 GCTTGCAACTCATGCAGATGAGG + Intergenic
1051017349 9:12494888-12494910 TCTTGAAGCTCTTCCAAATTTGG + Intergenic
1051687313 9:19671306-19671328 TTTTGCAGCTATTGCAAAAGGGG + Intronic
1056115670 9:83438982-83439004 AGGTGCAGCTCCTGCAAAAGAGG - Intronic
1056889401 9:90476812-90476834 TTTTGTAGCACCTGCAAAAGTGG - Intergenic
1057227796 9:93301689-93301711 TCTTCCGGCTCCTGCATGTGCGG + Intronic
1058680830 9:107438837-107438859 TCATGCAGCTCCTTGAAATGAGG - Intergenic
1060249750 9:121976285-121976307 CCTTACAGCTCCTACAACTGGGG + Intronic
1061369145 9:130188041-130188063 TCTTGCAGTTCCTGCCCCTGTGG + Intronic
1186039612 X:5461605-5461627 CCTTACATCTCCTGAAAATGGGG - Intergenic
1186251625 X:7673431-7673453 TCTTGATGCTATTGCAAATGAGG - Intergenic
1187168307 X:16825998-16826020 TATTGTAGCTAGTGCAAATGAGG - Intronic
1187256813 X:17650729-17650751 TCTTCCAGCTCCTGTAAAATAGG + Intronic
1190126112 X:47707186-47707208 TCCTGGCCCTCCTGCAAATGAGG - Intergenic
1192113964 X:68393181-68393203 TGTTGCATGTCCTGCAAGTGGGG + Intronic
1192161080 X:68788064-68788086 TCTTTCAGATCCTGGATATGTGG + Intergenic
1192637572 X:72833827-72833849 TTTTGTAGCTACTGTAAATGGGG - Intronic
1192644142 X:72886987-72887009 TTTTGTAGCTACTGTAAATGGGG + Intronic
1193412886 X:81185366-81185388 ATTTGTAGCTACTGCAAATGGGG + Intronic
1193496505 X:82219734-82219756 TCATGCAGCCCCTCCCAATGAGG + Intergenic
1194646944 X:96469280-96469302 TCTTGCATTTCCTGTAAATTGGG + Intergenic
1196794215 X:119489406-119489428 CGTTGCAGCTCCTGCTAATAGGG - Intergenic
1196935110 X:120722374-120722396 TTTTGCAGCTGCTGTAAAAGGGG + Intergenic
1197054602 X:122101738-122101760 TTTTGCAGCTGTTGTAAATGGGG - Intergenic