ID: 1174044603

View in Genome Browser
Species Human (GRCh38)
Location 20:47724540-47724562
Sequence AGCTCCTGCAAATGAGGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174044599_1174044603 -1 Left 1174044599 20:47724518-47724540 CCGCTCCCTAGAAGGGTCTTGCA 0: 1
1: 0
2: 1
3: 17
4: 135
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1174044594_1174044603 25 Left 1174044594 20:47724492-47724514 CCTAATTAAATGCTGGCTCCAGC 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1174044601_1174044603 -7 Left 1174044601 20:47724524-47724546 CCTAGAAGGGTCTTGCAGCTCCT 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1174044595_1174044603 7 Left 1174044595 20:47724510-47724532 CCAGCCATCCGCTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1174044600_1174044603 -6 Left 1174044600 20:47724523-47724545 CCCTAGAAGGGTCTTGCAGCTCC 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201
1174044598_1174044603 3 Left 1174044598 20:47724514-47724536 CCATCCGCTCCCTAGAAGGGTCT 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG 0: 1
1: 0
2: 1
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174044603 Original CRISPR AGCTCCTGCAAATGAGGATG AGG Intronic
901449509 1:9327407-9327429 AGCTGCTGGAAATGAGGTTCTGG + Intronic
901633836 1:10660532-10660554 CTCTCCTGCAGAGGAGGATGGGG + Exonic
902529144 1:17079271-17079293 AGCTGCTCCCGATGAGGATGCGG + Exonic
907943489 1:59111113-59111135 AGCACCTGCTCATGAGAATGCGG + Intergenic
908582715 1:65532839-65532861 AGCGACTGCTAATGAGGAAGAGG + Intronic
909261442 1:73494341-73494363 AGCTCCTCCAAATGAAAATTTGG + Intergenic
910920759 1:92343931-92343953 AGCTGATGCAAAGGAGGAAGAGG + Intronic
911015390 1:93326446-93326468 ATCTGCTGAGAATGAGGATGAGG + Intergenic
912356487 1:109058266-109058288 AGGTCCTGGGAATTAGGATGTGG - Intergenic
914421767 1:147534872-147534894 AACTCCTTCTAATGAAGATGTGG - Intergenic
915670095 1:157481656-157481678 AGCTCATGCCAATGAGGATTAGG - Intergenic
915704067 1:157826634-157826656 AGATCCTGTAAGTTAGGATGGGG - Intergenic
916479614 1:165202981-165203003 AGCATCTGCAAATGTGGATGAGG - Exonic
917644946 1:177020664-177020686 AGGTCCTGGAGATGAGAATGTGG + Intronic
919106453 1:193157574-193157596 AGCTCCTGCTCAGGTGGATGTGG - Intronic
920355994 1:205373129-205373151 AGGTACTGCAGATGTGGATGAGG - Intergenic
920442488 1:205990215-205990237 AGCGCTTGAAAATGAGGATTAGG + Intronic
920813044 1:209305014-209305036 CTCTCCAGCAAGTGAGGATGGGG + Intergenic
921213517 1:212919078-212919100 AGATCATGCAGATGAAGATGAGG - Intergenic
922566701 1:226605877-226605899 TGGTCCTGCACATTAGGATGGGG - Exonic
923152026 1:231241734-231241756 AGCTCCTGGACACGAGAATGAGG + Intronic
923488029 1:234455069-234455091 AGCTCCAGAAGATGAGGAAGTGG + Intronic
924549918 1:245065999-245066021 TGCTTCTGGAAATGAGGATGAGG - Intronic
1064039089 10:11942476-11942498 ACCTCATGCAAATCAGGATGTGG + Intronic
1064210644 10:13358055-13358077 AGGTTCTGGAGATGAGGATGAGG - Intergenic
1064382006 10:14852618-14852640 TCCTGCTGCAAAGGAGGATGTGG + Intronic
1065227006 10:23554419-23554441 AGTTTCTGCAAATGAGTATGAGG - Intergenic
1065333020 10:24623684-24623706 ACCACCTGAAAAGGAGGATGGGG + Intronic
1066225337 10:33377226-33377248 AGCTGCTGCAATTGAAGTTGGGG - Intergenic
1067037407 10:42930735-42930757 ACCTTCTGAAAATGAGGGTGCGG - Intergenic
1067785256 10:49241173-49241195 CTCTCCTGCAAATGAGGTTGGGG - Intergenic
1070026533 10:72637376-72637398 AACTCCTGGAAATGAAGCTGTGG + Intergenic
1070710231 10:78675951-78675973 AACCCCTGCAAATGAGGTTTTGG - Intergenic
1071786565 10:88907018-88907040 AGTTCCAGCAGTTGAGGATGGGG - Intronic
1073281278 10:102356108-102356130 AGCTCCTTCCAATAAAGATGAGG - Intronic
1076611763 10:131730376-131730398 AGCTCCTGCAACCCAGGCTGTGG - Intergenic
1077333682 11:1994217-1994239 AGCCCCTGGAAATAAGGGTGGGG - Intergenic
1078206368 11:9233484-9233506 AGCTTCTGGAGATTAGGATGTGG - Intronic
1078703113 11:13708944-13708966 AGCTGCAGCAAATGAGAATAAGG - Intronic
1079494010 11:21020670-21020692 AGCTACTGCAGATGAGGGAGAGG - Intronic
1080062109 11:27967900-27967922 GGCTCCTGCAAATGAGGGAATGG + Intergenic
1084443981 11:69192840-69192862 AGGGCCTGCAAAGGAGGCTGTGG - Intergenic
1085737437 11:79051051-79051073 AGCACTTCCAAATGAGAATGAGG + Intronic
1086767267 11:90712308-90712330 AGCAGATGCTAATGAGGATGTGG - Intergenic
1087098222 11:94340068-94340090 AGATCCTGAAAATCAGGGTGTGG - Intergenic
1089158822 11:116422587-116422609 AGCTGCTGCAGATGAGGTTAAGG - Intergenic
1089332619 11:117700490-117700512 AGCTCCTGCTTCTCAGGATGTGG - Intronic
1089839122 11:121399064-121399086 AGGTCCTGGGAATTAGGATGTGG - Intergenic
1202816663 11_KI270721v1_random:49399-49421 AGCCCCTGGAAATAAGGGTGGGG - Intergenic
1092229673 12:6769585-6769607 AGGTCCTGCAAAGGAGAAAGAGG - Exonic
1093074501 12:14743609-14743631 AGCTCCGGCACAGGAGGAAGTGG - Intergenic
1096356739 12:50947656-50947678 AGGTTCTGGAAATTAGGATGTGG + Intergenic
1101442959 12:104717198-104717220 AGCTTCTGCAGGTTAGGATGTGG + Intronic
1102106877 12:110332695-110332717 AGATCCTTTAAATGAGGAGGAGG - Intronic
1102549081 12:113677966-113677988 AGCTTCTGCAAAACAGGATGTGG + Intergenic
1103020281 12:117528449-117528471 AGGTCCCCCAAATGAGGATGGGG - Intronic
1104549708 12:129745347-129745369 AACACCCGCAAATGCGGATGTGG + Intronic
1109098703 13:58150806-58150828 AGCTCCTTCAAATTAGAAGGAGG - Intergenic
1109168762 13:59069844-59069866 AGCTCCTGCCAATTTGGTTGTGG - Intergenic
1110849942 13:80233391-80233413 AGCTCATGAGCATGAGGATGTGG - Intergenic
1111771137 13:92597222-92597244 AACTCCAGAAGATGAGGATGTGG - Intronic
1112392922 13:99001780-99001802 AGCCCCTGCAAGGGAGCATGCGG - Intronic
1114069471 14:19096174-19096196 GGCTCCCTCAAATCAGGATGGGG - Intergenic
1114092791 14:19303829-19303851 GGCTCCCTCAAATCAGGATGGGG + Intergenic
1118828247 14:69404111-69404133 AGCTACTCCAAATGCTGATGTGG + Intronic
1118888594 14:69887936-69887958 AGCTCCTGCAAAAGGCGGTGAGG - Intronic
1120471965 14:84937252-84937274 AGGTCCAGCAAATGAGAGTGGGG - Intergenic
1120520765 14:85525707-85525729 ACCTCATTCAAATGATGATGAGG - Intergenic
1121240753 14:92428346-92428368 AGCTCCTCCAAATGAGAAGTAGG + Intronic
1121372058 14:93368376-93368398 ATCTTCTGCAAAAGATGATGGGG + Intronic
1121587457 14:95072052-95072074 GGCCCCTGCGGATGAGGATGGGG - Intergenic
1121930292 14:97966168-97966190 AGCTCCAGCAAAAGATGGTGAGG - Intronic
1121987202 14:98518598-98518620 AGTCCCTACAAAGGAGGATGTGG + Intergenic
1123476117 15:20593473-20593495 AGTTCCTGCAGCTGTGGATGGGG + Intergenic
1123641895 15:22406891-22406913 AGTTCCTGCAGCTGTGGATGGGG - Intergenic
1124094389 15:26635359-26635381 AGCTCCTGCAGATGACCATAAGG + Intronic
1126727298 15:51644792-51644814 GGCTCCTGTTAATGAAGATGAGG + Intergenic
1127624434 15:60766431-60766453 AGCTCTTTGAAATGAGGCTGAGG - Intronic
1128459050 15:67852556-67852578 AGCTCCAGGAAATGAGGGTGAGG - Intergenic
1129185244 15:73902162-73902184 AGGTTCTGGAAATTAGGATGGGG + Intergenic
1129823567 15:78620292-78620314 ATCTCCGTCAAATGAGGAGGTGG + Intronic
1131549680 15:93346647-93346669 AGCTACTGCATATGGGGAAGAGG - Intergenic
1131669268 15:94601852-94601874 ATTTCCTGCAAGTGAGAATGGGG - Intergenic
1132018536 15:98339956-98339978 AGGTTCTGGAAATTAGGATGTGG + Intergenic
1132193206 15:99887567-99887589 AACTCCAGAAGATGAGGATGTGG + Intergenic
1133785813 16:8972274-8972296 AGCTCCTGCTCAGGAGGCTGAGG + Intergenic
1134539282 16:15051814-15051836 AGCTACTGCAAAGGAGGCTGAGG - Intronic
1134692793 16:16202031-16202053 AGGTGCTGCAGATGAGGTTGCGG - Exonic
1135771991 16:25224684-25224706 AGGTGCTGCAAATGGGGAGGGGG + Intronic
1136069346 16:27778702-27778724 AGCTCCTGGGACTGAGGGTGAGG - Exonic
1138477559 16:57281108-57281130 AGCTCCTGGAAAGCAGGCTGTGG + Intronic
1140136142 16:72207216-72207238 GGCTGCTGCACATGAGGAGGAGG + Intergenic
1140730692 16:77853197-77853219 AGAGCCTGCTAATGGGGATGGGG + Intronic
1140743500 16:77962064-77962086 AGGTTCTGGAAATTAGGATGTGG - Intronic
1140965820 16:79964994-79965016 AACTCCTGCAGGTGATGATGTGG + Intergenic
1141476058 16:84274275-84274297 AGCCTCTGGAAATAAGGATGGGG + Intergenic
1142341264 16:89524321-89524343 GGCTCCTGTGAATGAGGGTGTGG + Intronic
1142418849 16:89958048-89958070 AGCTCCTGGAAAGCAAGATGTGG - Intronic
1144057450 17:11555633-11555655 AGGTCCAGGAAAGGAGGATGGGG + Intronic
1144402415 17:14919014-14919036 AGTTCCTACAGATGGGGATGTGG + Intergenic
1145294084 17:21574538-21574560 AGCTCCTGGAAGTCAGGCTGAGG + Intergenic
1145369751 17:22298648-22298670 AGCTCCTGGAAGTCAGGCTGAGG - Intergenic
1146624573 17:34425415-34425437 TGCTCCTGCAAGTCAGGCTGGGG - Intergenic
1150829848 17:68509804-68509826 AGCCCCAGCATATGAGGATTTGG + Intergenic
1151307055 17:73269752-73269774 AGTTTCTGGAAATTAGGATGTGG - Intergenic
1155257591 18:24012474-24012496 AGGCCCTGCAGCTGAGGATGTGG - Intronic
1157625666 18:49048768-49048790 AAATCCTGCAAAAGAGGATCTGG + Intronic
1158571134 18:58597943-58597965 AGCTTCTGCAAACCAGGAAGAGG + Intronic
1160971724 19:1771239-1771261 GGGTCCTCCAAATCAGGATGAGG - Intronic
1161897734 19:7095191-7095213 AGCTGCTGCAGCTGAGGAGGTGG - Intergenic
1162384667 19:10353802-10353824 AGCTCCCTCAAGTGAGAATGGGG - Intronic
1163188793 19:15659864-15659886 AGCGACTGCTAATCAGGATGGGG + Exonic
1164869048 19:31628165-31628187 ATCTCTTGCCAATGAGGCTGTGG - Intergenic
1165017046 19:32889091-32889113 AGCTCCTGGAGACCAGGATGGGG + Intronic
1167421898 19:49408949-49408971 AGTTCCTGCAAAGGAGGAAGTGG - Exonic
926898709 2:17725559-17725581 AGCTTTTGCAAATGAACATGTGG - Intronic
928290897 2:30036490-30036512 ACCTTCTGAAAATGAGGATACGG + Intergenic
928375045 2:30767121-30767143 ATCACATGCAGATGAGGATGGGG - Intronic
928426253 2:31180623-31180645 ATTTCCTGGGAATGAGGATGAGG - Intronic
929218364 2:39438307-39438329 AGCTCCTGCAAATGTCTATTGGG - Intergenic
931603961 2:64033031-64033053 ATCTCCTGCAAATGAGAACCTGG + Intergenic
932152427 2:69385864-69385886 AGCTTCTGAAAATGAGGAGCAGG - Intronic
933250918 2:80027557-80027579 AGCTCCGGCAAGAGAGGTTGAGG + Intronic
936517818 2:113193240-113193262 AGCTCCTGCAAAGGAGGGCCAGG - Exonic
936593993 2:113830304-113830326 TGTATCTGCAAATGAGGATGTGG - Intergenic
938035988 2:128035390-128035412 AGCTACTGCAGAGGATGATGTGG - Intergenic
938189015 2:129257557-129257579 AGTTCCTGCAATGGAGGATGTGG - Intergenic
939007726 2:136808666-136808688 AGCAAGTGCTAATGAGGATGTGG - Intronic
940158265 2:150682241-150682263 AGCTCCTCCAGTTGATGATGGGG - Intergenic
942825200 2:180167345-180167367 AGCTCCTGTTAATGAGGAAAGGG - Intergenic
946367277 2:219256520-219256542 AGGTCCTGGAGATGAGGATGTGG - Intronic
946653073 2:221915175-221915197 ACCTACTGCTAATGAAGATGAGG + Intergenic
1169247837 20:4037880-4037902 AGCTTCTGGAGATTAGGATGTGG + Intergenic
1174044603 20:47724540-47724562 AGCTCCTGCAAATGAGGATGAGG + Intronic
1174087324 20:48018559-48018581 AGCTCCTGAAAATGACCATGTGG + Intergenic
1174128963 20:48328411-48328433 AGCTCCTGAAAATGGTCATGTGG - Intergenic
1174963394 20:55183767-55183789 AGTGACTGCAAATGAGCATGAGG + Intergenic
1176066113 20:63196822-63196844 AGCACCTGCAAATCTGGAGGCGG + Intronic
1177220033 21:18180609-18180631 GACTCCTGCCAATGTGGATGAGG + Intronic
1179632042 21:42684632-42684654 GAGTCCTGCAAAGGAGGATGTGG + Intronic
1180085666 21:45506990-45507012 AGCCCCTGAAAGTTAGGATGGGG - Intronic
1180487941 22:15818737-15818759 GGCTCCCTCAAATCAGGATGGGG - Intergenic
1181899792 22:26144084-26144106 TGCTGCTGCATATGTGGATGTGG + Intergenic
1183753799 22:39740143-39740165 AGCAGCTGCTAATGGGGATGAGG + Intergenic
949903202 3:8837099-8837121 AGCTGCTGAAAATGAGGTTAAGG + Intronic
950199632 3:11034088-11034110 AGCTCCTGCTTGTGGGGATGAGG - Intronic
950235496 3:11316554-11316576 TGGACCTGCAAATGAGGATCAGG - Intronic
950483536 3:13259478-13259500 GGCTTCTGGAAATGAGGACGTGG - Intergenic
951214861 3:20014352-20014374 ATATCCTGAAAAGGAGGATGGGG - Intergenic
952266518 3:31792149-31792171 AGCTCACGCAATTGAGGCTGCGG + Intronic
954002836 3:47571401-47571423 AGCAGCTGCTGATGAGGATGGGG - Intronic
954671852 3:52295316-52295338 AGCTTCAGAAAATGACGATGAGG - Intergenic
955343738 3:58145664-58145686 AGCTGCTCCAGATGAGGAAGGGG - Intronic
956021457 3:64937795-64937817 AGTTCCTGCTAATCAGGCTGAGG - Intergenic
956096006 3:65716965-65716987 AGATCCTGCAGAGCAGGATGAGG - Intronic
957687903 3:83526780-83526802 AGCTAATGCAAATGAGAGTGAGG - Intergenic
960270950 3:115674036-115674058 AGCTCCTGCTAATCATGATGTGG - Intronic
960325013 3:116285176-116285198 ACCTGGTGCAAATGGGGATGGGG - Intronic
961828738 3:129612390-129612412 AGCTCCTGTCATTGGGGATGTGG - Intergenic
965695538 3:171404301-171404323 AGCTTCTGGAAATGTGGAGGAGG - Intronic
966775742 3:183541331-183541353 AGCTCCTCCAGCTGGGGATGGGG + Intronic
969195738 4:5562545-5562567 AGCTTCTGCAGCAGAGGATGGGG + Exonic
971733738 4:30418941-30418963 AACTCCTGAGAATGGGGATGGGG - Intergenic
972611117 4:40656562-40656584 AGCTCCTTCAAAAGAGGATGTGG + Intergenic
972944342 4:44236078-44236100 AGTGCCTGCAACTGAGGATAAGG + Intronic
975467714 4:74728329-74728351 ATCTTCTTCAAATGTGGATGAGG + Intergenic
976843509 4:89459859-89459881 AGCTCCTGTAAATTGGGGTGGGG + Intergenic
977491931 4:97725104-97725126 AGCATGTGCAAATGAGGATGAGG + Intronic
977847871 4:101787462-101787484 AGGTTCTGCAGATGAGAATGTGG + Intronic
981360992 4:143845520-143845542 AACTCCTGAAAATTAGGAAGGGG - Intergenic
981371731 4:143966522-143966544 AACTCCTGAAAATTAGGAAGGGG - Intergenic
981380820 4:144069720-144069742 AACTCCTGAAAATTAGGAAGGGG - Intergenic
983203771 4:164890374-164890396 AGTGCCTGCTAATGAGAATGGGG - Intronic
989315222 5:40070609-40070631 AGCACCTGAAAATGTGGAAGTGG + Intergenic
992115576 5:73535783-73535805 AGGTCCTGGGAATTAGGATGTGG - Intergenic
993775786 5:91993888-91993910 AGATGCTGGAAATTAGGATGTGG - Intergenic
997264205 5:132485696-132485718 AGCTACAACAGATGAGGATGAGG - Exonic
1001677392 5:173530004-173530026 GGCTGCTGCAAGTGAGCATGTGG + Intergenic
1003133372 6:3414459-3414481 AGCACTTGCAAATCATGATGAGG + Intronic
1003506853 6:6746713-6746735 AGCTGCTGCAGATAAGGACGGGG + Intergenic
1003634910 6:7823172-7823194 ATCTCCTGCAGATGATGATGAGG + Intronic
1004912954 6:20304330-20304352 AGAGGCTGCAAATGGGGATGGGG + Intergenic
1006090828 6:31627794-31627816 AGCACCTGAAGATGAGGATGAGG + Exonic
1007580272 6:42954567-42954589 AACACCTTCAAATAAGGATGAGG - Intergenic
1008147872 6:47913404-47913426 AGTTTCTGGAAATGAGGATTGGG - Intronic
1008731272 6:54485439-54485461 AGATCCTGAGGATGAGGATGAGG - Intergenic
1009274260 6:61654965-61654987 GGCTTCTGCCAATGAGGATTTGG - Intergenic
1009421906 6:63473025-63473047 AATTTCTGCAAATTAGGATGGGG + Intergenic
1010346479 6:74816102-74816124 AGCTCATGCACAGGAGGATGTGG - Intergenic
1015459042 6:133467190-133467212 AATTCCTGCAGAAGAGGATGAGG - Intronic
1016017519 6:139201063-139201085 ATCTCCTGTGAATGAGGAAGAGG - Intergenic
1017866538 6:158448978-158449000 AGCACCTGCAATCCAGGATGGGG - Exonic
1023684019 7:42716939-42716961 AGCCCATGGAAGTGAGGATGGGG - Intergenic
1024752391 7:52482910-52482932 ACCTCATGCAAATGAAGTTGTGG + Intergenic
1025869111 7:65414304-65414326 ATCTACTGCAAATTAGGGTGCGG + Intergenic
1028949616 7:96620079-96620101 AGCTGCTGCTAAGGAGGATCAGG - Intronic
1030091398 7:105862005-105862027 CGCTTCTGCAAAAGATGATGAGG + Intronic
1031159138 7:118144989-118145011 AGATTCTGAAAATTAGGATGTGG + Intergenic
1033652702 7:143354605-143354627 AGCTCCTGGAAATGAGGTCCTGG + Exonic
1035570177 8:667429-667451 AGATCCTGGAGATGAGGCTGTGG - Intronic
1037676438 8:21054999-21055021 AGCTTCTGCAGATGAGGGTGAGG + Intergenic
1037760640 8:21739339-21739361 AGCCTCTGCACCTGAGGATGGGG + Intronic
1039582145 8:38675475-38675497 TGCTGCTGGAAGTGAGGATGGGG + Intergenic
1039787489 8:40846734-40846756 AGCTGCTGCAAACGTGTATGAGG + Intronic
1040018644 8:42720879-42720901 CTATCCTGCAAAGGAGGATGGGG - Intronic
1040478035 8:47797922-47797944 TGCCCCTGCAGATGAGGCTGTGG - Intronic
1042387336 8:68192493-68192515 CGCTGCTGCACATGATGATGTGG - Exonic
1045848602 8:106666359-106666381 AGCTAATGCAAATGAGGAACTGG + Intronic
1047196600 8:122727282-122727304 AGCTCCTGCACATTAGCATCTGG - Intergenic
1048597528 8:135882114-135882136 AGGTCCTGCATATGAGGAGGTGG + Intergenic
1050105467 9:2161766-2161788 AGATCCTGCAAAAGAAGATGTGG + Exonic
1051663467 9:19446422-19446444 AGCCCCTGCTAATGGGGAGGTGG + Intronic
1052025550 9:23569929-23569951 AGCTACTGCCAAGGATGATGGGG + Intergenic
1054951896 9:70861536-70861558 AAGTGCTGTAAATGAGGATGTGG - Intronic
1056115668 9:83438976-83438998 AGCTCCTGCAAAAGAGGTGAGGG - Intronic
1056581167 9:87888772-87888794 AGTTCCTGCAGCTGTGGATGGGG - Exonic
1061192307 9:129088953-129088975 TGTTCCTGCAAAACAGGATGGGG - Exonic
1061350493 9:130060679-130060701 AGATGCTGCAAATGAGCAAGTGG + Intronic
1061534109 9:131237012-131237034 AGCTGCTGCAAGGCAGGATGAGG - Intergenic
1190357068 X:49616076-49616098 AGATCCTGGAAATTAGGATATGG + Intergenic
1192319449 X:70077764-70077786 AACTCCTCCAAATAAGGAAGGGG + Intergenic
1192336599 X:70225980-70226002 AGCTCCTGCAAATCAATAAGAGG + Intergenic
1195961950 X:110395748-110395770 ATCTCCTGGGAATGAGGATGGGG + Intronic
1196611263 X:117717280-117717302 AGATTCTAAAAATGAGGATGTGG - Intergenic
1198213722 X:134537748-134537770 AGCACCTGCAAAAGTGGGTGGGG - Intergenic
1198928940 X:141831345-141831367 AGGCCTTGGAAATGAGGATGGGG - Intergenic