ID: 1174044605

View in Genome Browser
Species Human (GRCh38)
Location 20:47724556-47724578
Sequence GATGAGGCCCATTCATTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174044599_1174044605 15 Left 1174044599 20:47724518-47724540 CCGCTCCCTAGAAGGGTCTTGCA 0: 1
1: 0
2: 1
3: 17
4: 135
Right 1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 110
1174044598_1174044605 19 Left 1174044598 20:47724514-47724536 CCATCCGCTCCCTAGAAGGGTCT 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 110
1174044601_1174044605 9 Left 1174044601 20:47724524-47724546 CCTAGAAGGGTCTTGCAGCTCCT 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 110
1174044600_1174044605 10 Left 1174044600 20:47724523-47724545 CCCTAGAAGGGTCTTGCAGCTCC 0: 1
1: 0
2: 1
3: 6
4: 118
Right 1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 110
1174044595_1174044605 23 Left 1174044595 20:47724510-47724532 CCAGCCATCCGCTCCCTAGAAGG 0: 1
1: 0
2: 0
3: 10
4: 89
Right 1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174044605 Original CRISPR GATGAGGCCCATTCATTCCC TGG Intronic
900980764 1:6044920-6044942 AATGAGGCCCTCTCCTTCCCTGG - Intronic
901813622 1:11781539-11781561 TATGCAGCCCAATCATTCCCCGG + Intronic
904444355 1:30555909-30555931 GGGGAGGCCCCTTCATTCCTTGG + Intergenic
908842519 1:68294056-68294078 AATGAGGCCAATTCATTCTTTGG + Intergenic
909961973 1:81857191-81857213 GATGAGATTGATTCATTCCCAGG + Intronic
913998444 1:143671652-143671674 GATGAGGCCCACTCACACTCAGG + Intergenic
914508934 1:148314064-148314086 GATGAGGTCCACTCACACCCAGG + Intergenic
915920919 1:159974527-159974549 GATCAGGCTCCTTCAATCCCTGG - Intergenic
918186993 1:182136414-182136436 AGTGAGGGCCATTCATTCCTTGG - Intergenic
918479659 1:184964914-184964936 GCTGAGACCCATTAATTCACTGG - Intronic
919751513 1:201040864-201040886 GATGAGGCCCAATCAACTCCAGG + Intronic
921888125 1:220326734-220326756 GATGTGGCTCATACTTTCCCTGG - Intergenic
923572882 1:235132103-235132125 GATAAGCCCCATCCAATCCCAGG + Intronic
924277546 1:242403766-242403788 GATGGGGCTCATTCACACCCAGG - Intronic
1063262101 10:4400996-4401018 GATGAGGCCCACTCATTTTAGGG + Intergenic
1072951492 10:99850464-99850486 GAAGAGGCCCAAACATTCCAGGG + Intronic
1075018424 10:118928411-118928433 CATGAGGTCCCTTCCTTCCCTGG + Intergenic
1075610654 10:123852177-123852199 GAGCAGGTGCATTCATTCCCTGG - Intronic
1076197966 10:128533741-128533763 GATGAGGCCCAGAGAGTCCCAGG - Intergenic
1079289905 11:19178629-19178651 GATGATTCCCATCCATGCCCTGG - Intergenic
1079330189 11:19526793-19526815 GCTGAGGTCCATTACTTCCCTGG + Intronic
1081599214 11:44480977-44480999 GATGAGTCCCAGGCACTCCCAGG - Intergenic
1084539509 11:69777034-69777056 GATGAGGCTCCTTTCTTCCCAGG + Intergenic
1085403600 11:76248710-76248732 GATGAGGCCCTGTCACCCCCCGG + Intergenic
1087622478 11:100558176-100558198 GATCAGGCTCATAAATTCCCAGG - Intergenic
1107165207 13:37275777-37275799 GATCAGCCCCATTCATTCAATGG + Intergenic
1112761693 13:102699321-102699343 GATGATGTCCATTTCTTCCCTGG + Intergenic
1112884680 13:104154763-104154785 GATGAAGCCCATTCATGCTTTGG + Intergenic
1115040166 14:28914726-28914748 GATGAGGCCCATACCTTTCCAGG - Intergenic
1119670305 14:76513448-76513470 GCTGTGGCCCAGTCTTTCCCAGG + Intergenic
1119870194 14:78010489-78010511 GGGGAGGCCCATTCATTGGCTGG + Intergenic
1120510731 14:85410928-85410950 GATGTGGCCCATGCAGTCCTCGG + Intergenic
1121681228 14:95794340-95794362 GCTGAGGCCCGTTCAATCCATGG + Intergenic
1126314025 15:47349036-47349058 GATGATGCCCATGGATGCCCTGG - Intronic
1127236108 15:57054183-57054205 AATGAGGCCCATGTACTCCCTGG - Intronic
1131812253 15:96184681-96184703 GCTAAGGCACATTCACTCCCAGG - Intergenic
1132920465 16:2387248-2387270 GATGACTCCCATGCATTTCCAGG - Intergenic
1142640772 17:1284653-1284675 AAAGAGGCACATTCATTCACAGG - Intronic
1147419392 17:40314622-40314644 GCTGAGGCCCATTCTTTGCCAGG + Intronic
1147660177 17:42113156-42113178 TATGGGGACCATTCATTCCCTGG - Exonic
1147910623 17:43853860-43853882 GCTGAGGCCCCTCCATTGCCAGG + Exonic
1152284862 17:79406479-79406501 GATGAGGCCTCTCCATTGCCTGG + Intronic
1152500806 17:80707779-80707801 GATGAGTTCCAAGCATTCCCTGG + Intronic
1156384189 18:36591330-36591352 GATGAGGGCAAGTCATGCCCTGG - Intronic
1157669667 18:49517694-49517716 GATGAGGCCCACCCATTCAATGG + Intergenic
1158879440 18:61762706-61762728 AATGAGGCCCATCAAGTCCCTGG + Intergenic
1161943236 19:7418919-7418941 GGAGAGGCCCTTCCATTCCCTGG - Intronic
1165015520 19:32877444-32877466 GCTCAGGACCATTCAGTCCCAGG - Intergenic
1165776771 19:38409160-38409182 GCAGGGGCCCATTCAGTCCCAGG - Exonic
1167631008 19:50626161-50626183 GACAAGGCCCAGTAATTCCCTGG + Intronic
1168489138 19:56793211-56793233 GATGAGGCCCATTCACTGACAGG + Intronic
925888329 2:8412381-8412403 CATGTGGCCCATTCCTTCGCAGG - Intergenic
935746519 2:106194101-106194123 GGGGAGCCCCATTCATTCCCCGG - Intronic
936537447 2:113323230-113323252 GAGGTGGCCCATTCATTTCTGGG - Intergenic
937336202 2:121063908-121063930 AATGAGGCCCACTCACTGCCTGG + Intergenic
938401413 2:130995172-130995194 GATGCTGCACATTCATTCACAGG - Intronic
945065519 2:205944674-205944696 GATGAGGCCCATGCCTGGCCTGG + Intergenic
945088647 2:206159014-206159036 GAGGAGGCCGTTTTATTCCCCGG - Intronic
947916107 2:233832829-233832851 GTGGAGTCCCTTTCATTCCCTGG + Intronic
948444059 2:238018470-238018492 AATCATGCCCATTCCTTCCCTGG - Intronic
948615435 2:239195455-239195477 GATGAGGCCCAAGCTGTCCCAGG + Intronic
1173707830 20:45125483-45125505 GATCAGCCCCACTCATACCCAGG + Intergenic
1174044605 20:47724556-47724578 GATGAGGCCCATTCATTCCCTGG + Intronic
1174244756 20:49169747-49169769 GATGAGGACCTTTCATCTCCTGG + Intronic
1175496406 20:59417530-59417552 AATGAGGCGCAATCATTCCATGG - Intergenic
1175526969 20:59641548-59641570 GATGAGGCCCACTCATGCTAGGG + Intronic
1177364004 21:20110424-20110446 GAGGAGGTCCATTCATTCAGTGG - Intergenic
1178486186 21:33021210-33021232 GATGGGGCCCAGTGTTTCCCTGG - Intergenic
1179836583 21:44038511-44038533 GCTGAGGCCCACTCGTTCCACGG - Intronic
1180732389 22:17991999-17992021 GATGAGGCGCCTCCATGCCCAGG + Intronic
1181493339 22:23274401-23274423 AATGAGGCAGATGCATTCCCAGG + Intronic
1181876604 22:25945422-25945444 GCTGAAGCCCATTCAGTGCCAGG - Intronic
1182534858 22:30993240-30993262 CATGAGGCCCAATTCTTCCCTGG + Intergenic
949897016 3:8775454-8775476 GTTGAGGCCAATTCATTAACAGG - Intronic
949905307 3:8853851-8853873 GCAGAGGCAGATTCATTCCCAGG + Intronic
950380885 3:12613800-12613822 GATAAGTCCCCTTCAGTCCCTGG - Intronic
956938728 3:74132961-74132983 CATGAGACCCATTCACTCTCAGG + Intergenic
957859974 3:85933904-85933926 GATGAGGCCCTTTCATATCATGG + Intronic
962026912 3:131557360-131557382 GATGAGCCCCACTAATCCCCAGG + Intronic
964546219 3:157836571-157836593 GATGAGAACCATTCTTTCCAAGG - Intergenic
964616007 3:158665876-158665898 GATGGGGCCTATACCTTCCCAGG + Intronic
965576284 3:170221906-170221928 GAGGAAGCCCAGTCATTTCCAGG + Intergenic
969944198 4:10765991-10766013 GATGAGGCCCATCCACACTCTGG + Intergenic
976491168 4:85672266-85672288 GATGAGGCCCTTTCAATTTCCGG + Intronic
977368991 4:96110744-96110766 GATGAGGCCCATTCACATCAAGG + Intergenic
985837111 5:2279679-2279701 GTTGAGGCCCATTTTCTCCCTGG - Intergenic
991635261 5:68698389-68698411 GATAAGGTTCATTCTTTCCCAGG - Intergenic
993157046 5:84239109-84239131 AATGAGGCCCATTCTTTGACAGG + Intronic
994075214 5:95642775-95642797 GCTGAGGCTCAGTCTTTCCCTGG - Intergenic
995843794 5:116471202-116471224 GATGATGCTCATTCATTTTCAGG - Intronic
996145786 5:119974157-119974179 GACAAGTCCCATTCATTCCGTGG - Intergenic
996565140 5:124872299-124872321 TATGTGACCCATTCATGCCCCGG + Intergenic
1000114749 5:158143257-158143279 GATGAGCCCATCTCATTCCCAGG - Intergenic
1001782999 5:174386541-174386563 GACGAGGCCCATCCATCCCAAGG - Intergenic
1005021489 6:21423388-21423410 CATGAGGCCGATTGATTCCTGGG - Intergenic
1006409846 6:33866684-33866706 GATGAGCCCCATGCTTACCCTGG + Intergenic
1012015159 6:93840951-93840973 GATAAGGCCCACTCATACCAAGG + Intergenic
1012819688 6:104070243-104070265 GATGAGGCCCATTCATACTGGGG - Intergenic
1013354536 6:109335435-109335457 GAGGAGGCCCATTCAGGCCAGGG - Intergenic
1022060216 7:26785893-26785915 GAAGAGGCCCATACAGGCCCTGG + Intronic
1024928360 7:54642135-54642157 GATGAGGCCCATCCATACTGGGG - Intergenic
1029693527 7:102198301-102198323 GATGTGGCACATTGATCCCCTGG - Intronic
1033855109 7:145551840-145551862 GAAGAGGAGCATCCATTCCCCGG - Intergenic
1034455785 7:151168907-151168929 GATGAGCCCTATTCATTCCCGGG + Intronic
1034737333 7:153441167-153441189 TATGATGCCAATTCATTCTCAGG - Intergenic
1037220951 8:16519516-16519538 GAAGAGGCCCATACACTCTCTGG - Intronic
1047126899 8:121972720-121972742 GATGAAGCCCATGGATTTCCGGG + Intergenic
1048330995 8:133470781-133470803 AAGGAGGCCCACTCATGCCCAGG + Intronic
1051690860 9:19710658-19710680 GACAAGGCCCATTCATGACCAGG - Intronic
1052828532 9:33195611-33195633 TTTGAGGCCTGTTCATTCCCTGG + Intergenic
1186426298 X:9465893-9465915 GAAGAGCCCCATTCATACCCGGG + Intronic
1187891040 X:23935211-23935233 GATGAGGCCCCTGCATTTTCTGG + Exonic
1189379099 X:40489104-40489126 GTTGAGGGGCATCCATTCCCCGG - Intergenic
1195262692 X:103148960-103148982 GATGAGGCCCATTCACATTCTGG + Intergenic
1196364054 X:114903513-114903535 GATGAGGCCAATTTTATCCCTGG - Intronic
1198275655 X:135095664-135095686 GATGTGGCCCTTTCAAACCCTGG - Intergenic
1198310860 X:135425066-135425088 GATGTGGCCCTTTCAAACCCTGG + Intergenic
1198821220 X:140650494-140650516 GATGAGGCTCATGTATGCCCTGG - Intergenic
1200236315 X:154469490-154469512 GTTGGGGCCCATTCCTCCCCAGG + Intronic