ID: 1174048944

View in Genome Browser
Species Human (GRCh38)
Location 20:47754071-47754093
Sequence TAGGGAGTCAAATGCGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 78}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174048936_1174048944 23 Left 1174048936 20:47754025-47754047 CCTGGAAGCAGTTCCCCTGGGCA 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78
1174048942_1174048944 -10 Left 1174048942 20:47754058-47754080 CCAAATGACAGCTTAGGGAGTCA 0: 1
1: 0
2: 0
3: 10
4: 80
Right 1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78
1174048935_1174048944 24 Left 1174048935 20:47754024-47754046 CCCTGGAAGCAGTTCCCCTGGGC 0: 1
1: 0
2: 0
3: 22
4: 199
Right 1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78
1174048937_1174048944 10 Left 1174048937 20:47754038-47754060 CCCCTGGGCATTTGATAATTCCA 0: 1
1: 0
2: 1
3: 11
4: 170
Right 1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78
1174048939_1174048944 8 Left 1174048939 20:47754040-47754062 CCTGGGCATTTGATAATTCCAAA 0: 1
1: 0
2: 0
3: 17
4: 177
Right 1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78
1174048938_1174048944 9 Left 1174048938 20:47754039-47754061 CCCTGGGCATTTGATAATTCCAA 0: 1
1: 0
2: 0
3: 7
4: 156
Right 1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG 0: 1
1: 0
2: 0
3: 1
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174048944 Original CRISPR TAGGGAGTCAAATGCGTGCA GGG Intronic
902053203 1:13580258-13580280 AGGGGAGTCATGTGCGTGCACGG + Intergenic
902425894 1:16321623-16321645 TAGGCATTCAAATGAGTGTAAGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
909187429 1:72505904-72505926 TAGGGAGTCAAGTAAGTTCATGG - Intergenic
920751090 1:208678055-208678077 TAGGGAATCAAATGAATCCAGGG - Intergenic
921091361 1:211846978-211847000 TTGGGAGTCAAATGCATATATGG + Intergenic
924162609 1:241248741-241248763 TAGGGATTCAAACACGAGCAAGG + Intronic
1064913415 10:20428183-20428205 TAGCCAGTCTAATGGGTGCATGG - Intergenic
1067533549 10:47091961-47091983 TAGAGACACCAATGCGTGCATGG - Intergenic
1072715888 10:97752347-97752369 CAGAAAGTCAAATGCCTGCATGG - Intronic
1076470990 10:130718158-130718180 TAGGAAGTGAAATGAGAGCAAGG + Intergenic
1079102276 11:17549157-17549179 GAGGGAGACAAATGCGGGCCAGG - Intronic
1085173828 11:74469792-74469814 TAGGGAGCTCAATGCCTGCAAGG + Intergenic
1090023560 11:123148757-123148779 AAGCTAGTCAATTGCGTGCATGG + Intronic
1091366230 11:135022905-135022927 TAGGGAGTGAAATGGGTACTAGG + Intergenic
1098504536 12:71233978-71234000 TAGGTAGTAAAATGAGTACAAGG - Intronic
1104060352 12:125262832-125262854 CAGAAAGTCAAATGCCTGCAGGG - Intronic
1104486143 12:129152591-129152613 TAGTGAGCAAAATGCCTGCAGGG - Intronic
1108775131 13:53756867-53756889 TAGGGAGTAAAATGCATAAAGGG + Intergenic
1110371904 13:74750070-74750092 TAGGGTGTCTAATGGGTGGAAGG - Intergenic
1111314345 13:86533291-86533313 TAGGGTATCAAATGTGTCCATGG - Intergenic
1112389971 13:98974190-98974212 TAGGTATTCAAATGTGAGCAGGG + Intronic
1113911292 13:113842642-113842664 GAGGGAGTCAGACACGTGCAGGG + Intronic
1114854108 14:26416738-26416760 CAGGGAGTCAAAATCCTGCAAGG - Intergenic
1122768309 14:104085938-104085960 TGGGGAGTCAAATCCGCGCCTGG + Intronic
1125665880 15:41429826-41429848 AAGTGAATCAAATGAGTGCAGGG - Intronic
1128304085 15:66586744-66586766 TAGGGAGGCAGAGGAGTGCAGGG + Intronic
1128776622 15:70325207-70325229 TAGGGAGTCAGAGGTGAGCATGG - Intergenic
1129612454 15:77071288-77071310 TAGGGAGCCATCTGCGTCCAAGG - Intronic
1131872088 15:96773679-96773701 TAGGGAGTCAATTTCTTGGATGG - Intergenic
1134446939 16:14338167-14338189 TAGGCAGACAAATGGATGCATGG - Intergenic
1144242086 17:13322564-13322586 CAGGAAGTCAAATGACTGCAGGG + Intergenic
1147438296 17:40431387-40431409 TAGGCAGACAAATGGGTGGATGG - Intergenic
1150285275 17:63950588-63950610 TAAGGAGTCAAAAGCTTTCAGGG + Intronic
1150959840 17:69901219-69901241 TAGGGACTCAAAGGCTTCCACGG - Intergenic
1156713804 18:39981987-39982009 CAGGGAGTCAAAGACTTGCATGG - Intergenic
1158716697 18:59886868-59886890 TAGGAAGTCAAATGTGTCCTTGG + Intergenic
1164411497 19:28009538-28009560 CAGGGAGTCAAAGGGGAGCAGGG + Intergenic
1166199925 19:41230943-41230965 TAGGGAGTCATATGAGGGAAGGG - Intronic
926771174 2:16377118-16377140 AAGGAAGTCAAATGCATTCAGGG - Intergenic
939933398 2:148258967-148258989 TAGGGAGTCAAAGGCACTCAGGG + Intronic
945637133 2:212369355-212369377 TAGAAAGTCAAATGCGTACCAGG - Intronic
948641925 2:239380280-239380302 TAAGAAGTTAAATGTGTGCACGG - Intronic
1174048944 20:47754071-47754093 TAGGGAGTCAAATGCGTGCAGGG + Intronic
1174373531 20:50110599-50110621 TAGGCAGTGAAAAGAGTGCAGGG - Intronic
1183251336 22:36732502-36732524 CAGGGTGTCCACTGCGTGCAAGG - Intergenic
951836247 3:26986576-26986598 GAGAGAGTCAAATGATTGCAGGG - Intergenic
952971135 3:38651024-38651046 TAGAGAGCCAAATGGGTGCCAGG + Intergenic
954275071 3:49536594-49536616 TAGGGAGTGAAGTGTGTGCTGGG - Intergenic
955683792 3:61529378-61529400 TAAAGAGTCAAATGTGAGCAGGG + Intergenic
958584853 3:96073788-96073810 TAGGGAGTGAAATGGAGGCACGG + Intergenic
966826209 3:183967128-183967150 CAGGGAGTGAACAGCGTGCAGGG - Intronic
973141956 4:46780603-46780625 TAGGGAACCAAATGTCTGCAAGG - Intronic
973150824 4:46885976-46885998 TAGGCAGTAAAATGTCTGCATGG - Intronic
977749462 4:100591636-100591658 GAGGGAGCCACATGTGTGCAGGG + Intronic
980586515 4:134823623-134823645 TAGAGAGCCACATGCGTGGAAGG - Intergenic
988894066 5:35653140-35653162 TAGTGAGTCAAATGGGGGCTTGG - Intronic
1003034409 6:2630597-2630619 TAGTGAGTCAGATGCTTCCAGGG - Intronic
1005662883 6:28018235-28018257 TTGGGAGTCAAGTGAGTACAGGG - Intergenic
1010723914 6:79312201-79312223 TAGGGAGTCAAAGGCACTCAGGG + Intergenic
1013409715 6:109873072-109873094 TAGGGAGTCATATCCAGGCAGGG + Intergenic
1015592665 6:134837338-134837360 CATGGAGGCAAATGCGTTCATGG - Intergenic
1024750745 7:52462281-52462303 AAGGAAGTCAAATGGGTCCAAGG - Intergenic
1028471108 7:91207328-91207350 AAGGTATCCAAATGCGTGCAAGG - Exonic
1033438401 7:141355276-141355298 AAGGGAGTCAAAGGGGTGGATGG + Intronic
1035911542 8:3572076-3572098 GATGGAGCCAAATGCCTGCAGGG - Intronic
1036044086 8:5120218-5120240 TGGTGAGTCAAATGTGTGCTGGG + Intergenic
1038489329 8:27958487-27958509 CAAGGGGTGAAATGCGTGCACGG + Intronic
1042092393 8:65172924-65172946 TAGTGACTCAAATGAGTGAATGG - Intergenic
1043221581 8:77672460-77672482 TAGGGAATCAAATAAGGGCATGG - Intergenic
1045402602 8:101834188-101834210 GAGGGTGTGAAATGTGTGCAAGG + Intronic
1046606828 8:116380964-116380986 TAGGGAGTCAAAAAAGTGCTAGG - Intergenic
1048429689 8:134358568-134358590 GAGGGAGTCAGATGCTTGAAGGG - Intergenic
1049499007 8:142951396-142951418 TAAGGAATCAAAGGGGTGCAGGG - Intergenic
1051269232 9:15338895-15338917 TATGGAGGCAAATAAGTGCATGG - Intergenic
1056011235 9:82333046-82333068 AAGGGAGTCAAATAGGTGCATGG + Intergenic
1057116277 9:92525352-92525374 GATTGAGTCAAATGCTTGCAGGG - Intronic
1057794227 9:98144231-98144253 TAGGGAGTCATATATGTGCCAGG + Intronic
1061969305 9:134035386-134035408 TAGGCTGTCAAGTGAGTGCAGGG - Intronic
1186961454 X:14741134-14741156 TAGGGAGTTAATTGGGTGTATGG + Intergenic