ID: 1174054486

View in Genome Browser
Species Human (GRCh38)
Location 20:47788509-47788531
Sequence CTGTGGGCCTGGCGGACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174054474_1174054486 19 Left 1174054474 20:47788467-47788489 CCCCAGTCAGAGAGGGGATGCTT No data
Right 1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG No data
1174054476_1174054486 17 Left 1174054476 20:47788469-47788491 CCAGTCAGAGAGGGGATGCTTAC No data
Right 1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG No data
1174054482_1174054486 -9 Left 1174054482 20:47788495-47788517 CCCTTCTTCTGGGGCTGTGGGCC No data
Right 1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG No data
1174054483_1174054486 -10 Left 1174054483 20:47788496-47788518 CCTTCTTCTGGGGCTGTGGGCCT No data
Right 1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG No data
1174054475_1174054486 18 Left 1174054475 20:47788468-47788490 CCCAGTCAGAGAGGGGATGCTTA No data
Right 1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174054486 Original CRISPR CTGTGGGCCTGGCGGACACG TGG Intergenic
No off target data available for this crispr