ID: 1174055328

View in Genome Browser
Species Human (GRCh38)
Location 20:47794615-47794637
Sequence CTTTCATGCACCTCGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174055328_1174055340 11 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055340 20:47794649-47794671 TGTGGACAGTGTCTGGGGAGGGG No data
1174055328_1174055341 12 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055341 20:47794650-47794672 GTGGACAGTGTCTGGGGAGGGGG No data
1174055328_1174055336 5 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055336 20:47794643-47794665 CTGGGCTGTGGACAGTGTCTGGG No data
1174055328_1174055335 4 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055335 20:47794642-47794664 TCTGGGCTGTGGACAGTGTCTGG No data
1174055328_1174055345 30 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055345 20:47794668-47794690 GGGGGTGACGAGGGAGGTGCTGG No data
1174055328_1174055339 10 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055339 20:47794648-47794670 CTGTGGACAGTGTCTGGGGAGGG No data
1174055328_1174055342 20 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055342 20:47794658-47794680 TGTCTGGGGAGGGGGTGACGAGG No data
1174055328_1174055344 24 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055344 20:47794662-47794684 TGGGGAGGGGGTGACGAGGGAGG No data
1174055328_1174055337 6 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055337 20:47794644-47794666 TGGGCTGTGGACAGTGTCTGGGG No data
1174055328_1174055332 -7 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055332 20:47794631-47794653 ATGAAAGCCCATCTGGGCTGTGG No data
1174055328_1174055343 21 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055343 20:47794659-47794681 GTCTGGGGAGGGGGTGACGAGGG No data
1174055328_1174055338 9 Left 1174055328 20:47794615-47794637 CCGGCTGCCGAGGTGCATGAAAG No data
Right 1174055338 20:47794647-47794669 GCTGTGGACAGTGTCTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174055328 Original CRISPR CTTTCATGCACCTCGGCAGC CGG (reversed) Intergenic
No off target data available for this crispr