ID: 1174061172

View in Genome Browser
Species Human (GRCh38)
Location 20:47834035-47834057
Sequence CTGTGTCCGTTGAAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174061172_1174061177 9 Left 1174061172 20:47834035-47834057 CCCTCAAACTTCAACGGACACAG No data
Right 1174061177 20:47834067-47834089 CCCACAGTTAAACAGCAGCATGG No data
1174061172_1174061179 10 Left 1174061172 20:47834035-47834057 CCCTCAAACTTCAACGGACACAG No data
Right 1174061179 20:47834068-47834090 CCACAGTTAAACAGCAGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174061172 Original CRISPR CTGTGTCCGTTGAAGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr