ID: 1174062016

View in Genome Browser
Species Human (GRCh38)
Location 20:47839533-47839555
Sequence TGCCAGTACGGGGTCTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174062006_1174062016 14 Left 1174062006 20:47839496-47839518 CCAGCAATTGTGCCCCTTGTGCT No data
Right 1174062016 20:47839533-47839555 TGCCAGTACGGGGTCTCCATAGG No data
1174062007_1174062016 2 Left 1174062007 20:47839508-47839530 CCCCTTGTGCTGCTGTATCTTGG No data
Right 1174062016 20:47839533-47839555 TGCCAGTACGGGGTCTCCATAGG No data
1174062011_1174062016 0 Left 1174062011 20:47839510-47839532 CCTTGTGCTGCTGTATCTTGGGG No data
Right 1174062016 20:47839533-47839555 TGCCAGTACGGGGTCTCCATAGG No data
1174062009_1174062016 1 Left 1174062009 20:47839509-47839531 CCCTTGTGCTGCTGTATCTTGGG No data
Right 1174062016 20:47839533-47839555 TGCCAGTACGGGGTCTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174062016 Original CRISPR TGCCAGTACGGGGTCTCCAT AGG Intergenic
No off target data available for this crispr