ID: 1174063600

View in Genome Browser
Species Human (GRCh38)
Location 20:47849267-47849289
Sequence CGCAGGCTGTGATGCATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174063600_1174063603 17 Left 1174063600 20:47849267-47849289 CCACTAATGCATCACAGCCTGCG No data
Right 1174063603 20:47849307-47849329 CTAAGACACATCCTGTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174063600 Original CRISPR CGCAGGCTGTGATGCATTAG TGG (reversed) Intergenic
No off target data available for this crispr