ID: 1174065902

View in Genome Browser
Species Human (GRCh38)
Location 20:47865985-47866007
Sequence GCCAACCCAACTCATCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174065902_1174065906 -1 Left 1174065902 20:47865985-47866007 CCTGAAGGATGAGTTGGGTTGGC No data
Right 1174065906 20:47866007-47866029 CAGAGGGCATTCTAGCTAAAGGG No data
1174065902_1174065907 24 Left 1174065902 20:47865985-47866007 CCTGAAGGATGAGTTGGGTTGGC No data
Right 1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG No data
1174065902_1174065905 -2 Left 1174065902 20:47865985-47866007 CCTGAAGGATGAGTTGGGTTGGC No data
Right 1174065905 20:47866006-47866028 GCAGAGGGCATTCTAGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174065902 Original CRISPR GCCAACCCAACTCATCCTTC AGG (reversed) Intergenic
No off target data available for this crispr