ID: 1174069282

View in Genome Browser
Species Human (GRCh38)
Location 20:47888516-47888538
Sequence CAGCAGGGATGACCCCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174069282_1174069292 27 Left 1174069282 20:47888516-47888538 CCAGTGAGGGGTCATCCCTGCTG No data
Right 1174069292 20:47888566-47888588 ATCCCCATGCAGGGCCCTAGAGG No data
1174069282_1174069285 -7 Left 1174069282 20:47888516-47888538 CCAGTGAGGGGTCATCCCTGCTG No data
Right 1174069285 20:47888532-47888554 CCTGCTGTGAGATAAAACCGAGG No data
1174069282_1174069287 17 Left 1174069282 20:47888516-47888538 CCAGTGAGGGGTCATCCCTGCTG No data
Right 1174069287 20:47888556-47888578 GTGACTCCCCATCCCCATGCAGG No data
1174069282_1174069288 18 Left 1174069282 20:47888516-47888538 CCAGTGAGGGGTCATCCCTGCTG No data
Right 1174069288 20:47888557-47888579 TGACTCCCCATCCCCATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174069282 Original CRISPR CAGCAGGGATGACCCCTCAC TGG (reversed) Intergenic
No off target data available for this crispr