ID: 1174076775

View in Genome Browser
Species Human (GRCh38)
Location 20:47942843-47942865
Sequence CGCTGTGTGTCGAGGGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174076768_1174076775 15 Left 1174076768 20:47942805-47942827 CCTGGGGCTTGTGGTCAGATACC No data
Right 1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG No data
1174076765_1174076775 28 Left 1174076765 20:47942792-47942814 CCCTCAGCTAGAGCCTGGGGCTT No data
Right 1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG No data
1174076771_1174076775 -10 Left 1174076771 20:47942830-47942852 CCCAGCAAGGACTCGCTGTGTGT No data
Right 1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG No data
1174076770_1174076775 -6 Left 1174076770 20:47942826-47942848 CCTGCCCAGCAAGGACTCGCTGT No data
Right 1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG No data
1174076766_1174076775 27 Left 1174076766 20:47942793-47942815 CCTCAGCTAGAGCCTGGGGCTTG No data
Right 1174076775 20:47942843-47942865 CGCTGTGTGTCGAGGGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174076775 Original CRISPR CGCTGTGTGTCGAGGGCATG TGG Intergenic
No off target data available for this crispr