ID: 1174080874

View in Genome Browser
Species Human (GRCh38)
Location 20:47969877-47969899
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080874_1174080878 -7 Left 1174080874 20:47969877-47969899 CCACCCTGGAGATGCTACTCAGG No data
Right 1174080878 20:47969893-47969915 ACTCAGGAGAATAACCCTGCTGG No data
1174080874_1174080881 23 Left 1174080874 20:47969877-47969899 CCACCCTGGAGATGCTACTCAGG No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080874_1174080882 24 Left 1174080874 20:47969877-47969899 CCACCCTGGAGATGCTACTCAGG No data
Right 1174080882 20:47969924-47969946 TTCACCTTCTGCCCCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080874 Original CRISPR CCTGAGTAGCATCTCCAGGG TGG (reversed) Intergenic