ID: 1174080876

View in Genome Browser
Species Human (GRCh38)
Location 20:47969880-47969902
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080876_1174080878 -10 Left 1174080876 20:47969880-47969902 CCCTGGAGATGCTACTCAGGAGA No data
Right 1174080878 20:47969893-47969915 ACTCAGGAGAATAACCCTGCTGG No data
1174080876_1174080881 20 Left 1174080876 20:47969880-47969902 CCCTGGAGATGCTACTCAGGAGA No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080876_1174080882 21 Left 1174080876 20:47969880-47969902 CCCTGGAGATGCTACTCAGGAGA No data
Right 1174080882 20:47969924-47969946 TTCACCTTCTGCCCCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080876 Original CRISPR TCTCCTGAGTAGCATCTCCA GGG (reversed) Intergenic