ID: 1174080877

View in Genome Browser
Species Human (GRCh38)
Location 20:47969881-47969903
Sequence TTCTCCTGAGTAGCATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080877_1174080882 20 Left 1174080877 20:47969881-47969903 CCTGGAGATGCTACTCAGGAGAA No data
Right 1174080882 20:47969924-47969946 TTCACCTTCTGCCCCTGAAAGGG No data
1174080877_1174080881 19 Left 1174080877 20:47969881-47969903 CCTGGAGATGCTACTCAGGAGAA No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080877 Original CRISPR TTCTCCTGAGTAGCATCTCC AGG (reversed) Intergenic
No off target data available for this crispr