ID: 1174080878

View in Genome Browser
Species Human (GRCh38)
Location 20:47969893-47969915
Sequence ACTCAGGAGAATAACCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080876_1174080878 -10 Left 1174080876 20:47969880-47969902 CCCTGGAGATGCTACTCAGGAGA No data
Right 1174080878 20:47969893-47969915 ACTCAGGAGAATAACCCTGCTGG No data
1174080871_1174080878 20 Left 1174080871 20:47969850-47969872 CCTTTGGAAAAGGCTACTGAAAA No data
Right 1174080878 20:47969893-47969915 ACTCAGGAGAATAACCCTGCTGG No data
1174080874_1174080878 -7 Left 1174080874 20:47969877-47969899 CCACCCTGGAGATGCTACTCAGG No data
Right 1174080878 20:47969893-47969915 ACTCAGGAGAATAACCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080878 Original CRISPR ACTCAGGAGAATAACCCTGC TGG Intergenic