ID: 1174080879

View in Genome Browser
Species Human (GRCh38)
Location 20:47969907-47969929
Sequence GGTGAAAGCAGTCACCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080879_1174080887 6 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080887 20:47969936-47969958 CCCTGAAAGGGCTTGACTGTGGG No data
1174080879_1174080890 8 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080890 20:47969938-47969960 CTGAAAGGGCTTGACTGTGGGGG No data
1174080879_1174080889 7 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080889 20:47969937-47969959 CCTGAAAGGGCTTGACTGTGGGG No data
1174080879_1174080885 5 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080885 20:47969935-47969957 CCCCTGAAAGGGCTTGACTGTGG No data
1174080879_1174080881 -7 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080879_1174080891 9 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080891 20:47969939-47969961 TGAAAGGGCTTGACTGTGGGGGG No data
1174080879_1174080882 -6 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080882 20:47969924-47969946 TTCACCTTCTGCCCCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080879 Original CRISPR GGTGAAAGCAGTCACCAGCA GGG (reversed) Intergenic
No off target data available for this crispr