ID: 1174080881

View in Genome Browser
Species Human (GRCh38)
Location 20:47969923-47969945
Sequence TTTCACCTTCTGCCCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080877_1174080881 19 Left 1174080877 20:47969881-47969903 CCTGGAGATGCTACTCAGGAGAA No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080876_1174080881 20 Left 1174080876 20:47969880-47969902 CCCTGGAGATGCTACTCAGGAGA No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080880_1174080881 -8 Left 1174080880 20:47969908-47969930 CCTGCTGGTGACTGCTTTCACCT No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080874_1174080881 23 Left 1174080874 20:47969877-47969899 CCACCCTGGAGATGCTACTCAGG No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data
1174080879_1174080881 -7 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080881 20:47969923-47969945 TTTCACCTTCTGCCCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080881 Original CRISPR TTTCACCTTCTGCCCCTGAA AGG Intergenic
No off target data available for this crispr