ID: 1174080887

View in Genome Browser
Species Human (GRCh38)
Location 20:47969936-47969958
Sequence CCCTGAAAGGGCTTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174080880_1174080887 5 Left 1174080880 20:47969908-47969930 CCTGCTGGTGACTGCTTTCACCT No data
Right 1174080887 20:47969936-47969958 CCCTGAAAGGGCTTGACTGTGGG No data
1174080879_1174080887 6 Left 1174080879 20:47969907-47969929 CCCTGCTGGTGACTGCTTTCACC No data
Right 1174080887 20:47969936-47969958 CCCTGAAAGGGCTTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174080887 Original CRISPR CCCTGAAAGGGCTTGACTGT GGG Intergenic