ID: 1174081479

View in Genome Browser
Species Human (GRCh38)
Location 20:47973417-47973439
Sequence TGGACCAGATGCAGCGCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174081479_1174081483 -4 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081483 20:47973436-47973458 TCCACTTCTGGGACCCATTTGGG No data
1174081479_1174081486 4 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081486 20:47973444-47973466 TGGGACCCATTTGGGTCCCTGGG No data
1174081479_1174081487 8 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081487 20:47973448-47973470 ACCCATTTGGGTCCCTGGGCCGG No data
1174081479_1174081496 29 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081496 20:47973469-47973491 GGGGCTTCCTGTGGATGAGCCGG No data
1174081479_1174081493 20 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081493 20:47973460-47973482 CCCTGGGCCGGGGCTTCCTGTGG No data
1174081479_1174081497 30 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081497 20:47973470-47973492 GGGCTTCCTGTGGATGAGCCGGG No data
1174081479_1174081482 -5 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081482 20:47973435-47973457 GTCCACTTCTGGGACCCATTTGG No data
1174081479_1174081489 9 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081489 20:47973449-47973471 CCCATTTGGGTCCCTGGGCCGGG No data
1174081479_1174081485 3 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081485 20:47973443-47973465 CTGGGACCCATTTGGGTCCCTGG No data
1174081479_1174081491 10 Left 1174081479 20:47973417-47973439 CCGTCGGCGCTGCATCTGGTCCA No data
Right 1174081491 20:47973450-47973472 CCATTTGGGTCCCTGGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174081479 Original CRISPR TGGACCAGATGCAGCGCCGA CGG (reversed) Intergenic