ID: 1174086206

View in Genome Browser
Species Human (GRCh38)
Location 20:48009572-48009594
Sequence ATAAGTCATCTGCACAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174086206_1174086210 14 Left 1174086206 20:48009572-48009594 CCAGGCTTGTGCAGATGACTTAT No data
Right 1174086210 20:48009609-48009631 TGCTTTAGATGAAAGCATGATGG No data
1174086206_1174086211 20 Left 1174086206 20:48009572-48009594 CCAGGCTTGTGCAGATGACTTAT No data
Right 1174086211 20:48009615-48009637 AGATGAAAGCATGATGGTGCAGG No data
1174086206_1174086212 23 Left 1174086206 20:48009572-48009594 CCAGGCTTGTGCAGATGACTTAT No data
Right 1174086212 20:48009618-48009640 TGAAAGCATGATGGTGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174086206 Original CRISPR ATAAGTCATCTGCACAAGCC TGG (reversed) Intergenic
No off target data available for this crispr