ID: 1174087244

View in Genome Browser
Species Human (GRCh38)
Location 20:48018164-48018186
Sequence CAGGAGGCCATGGGTACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174087244_1174087250 -7 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087250 20:48018180-48018202 CCTCCTGTCCAGAAGGCCCTTGG No data
1174087244_1174087254 -2 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087254 20:48018185-48018207 TGTCCAGAAGGCCCTTGGGAGGG No data
1174087244_1174087258 9 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087258 20:48018196-48018218 CCCTTGGGAGGGCAGCCTGGAGG No data
1174087244_1174087261 21 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087261 20:48018208-48018230 CAGCCTGGAGGGTCAGTCATTGG No data
1174087244_1174087251 -6 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087251 20:48018181-48018203 CTCCTGTCCAGAAGGCCCTTGGG No data
1174087244_1174087256 6 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087256 20:48018193-48018215 AGGCCCTTGGGAGGGCAGCCTGG No data
1174087244_1174087260 10 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087260 20:48018197-48018219 CCTTGGGAGGGCAGCCTGGAGGG No data
1174087244_1174087253 -3 Left 1174087244 20:48018164-48018186 CCCTCTGTACCCATGGCCTCCTG No data
Right 1174087253 20:48018184-48018206 CTGTCCAGAAGGCCCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174087244 Original CRISPR CAGGAGGCCATGGGTACAGA GGG (reversed) Intergenic
No off target data available for this crispr