ID: 1174092163

View in Genome Browser
Species Human (GRCh38)
Location 20:48058260-48058282
Sequence CTGCATACCATGGAGTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174092163_1174092173 18 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092173 20:48058301-48058323 GTGGGTGGACCCACTCCACTTGG No data
1174092163_1174092168 -8 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092168 20:48058275-48058297 GTATGCAGAAATGTGGAGCAGGG No data
1174092163_1174092169 -4 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092169 20:48058279-48058301 GCAGAAATGTGGAGCAGGGCTGG No data
1174092163_1174092171 0 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092171 20:48058283-48058305 AAATGTGGAGCAGGGCTGGTGGG No data
1174092163_1174092176 30 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092176 20:48058313-48058335 ACTCCACTTGGCTGCTGAGCAGG No data
1174092163_1174092172 3 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092172 20:48058286-48058308 TGTGGAGCAGGGCTGGTGGGTGG No data
1174092163_1174092170 -1 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092170 20:48058282-48058304 GAAATGTGGAGCAGGGCTGGTGG No data
1174092163_1174092167 -9 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092167 20:48058274-48058296 GGTATGCAGAAATGTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174092163 Original CRISPR CTGCATACCATGGAGTATGG TGG (reversed) Intergenic
No off target data available for this crispr