ID: 1174092168

View in Genome Browser
Species Human (GRCh38)
Location 20:48058275-48058297
Sequence GTATGCAGAAATGTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174092163_1174092168 -8 Left 1174092163 20:48058260-48058282 CCACCATACTCCATGGTATGCAG No data
Right 1174092168 20:48058275-48058297 GTATGCAGAAATGTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174092168 Original CRISPR GTATGCAGAAATGTGGAGCA GGG Intergenic
No off target data available for this crispr