ID: 1174094253

View in Genome Browser
Species Human (GRCh38)
Location 20:48075508-48075530
Sequence GTAGCAGGGATGGAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174094253_1174094265 14 Left 1174094253 20:48075508-48075530 CCAGCACCTTCCATCCCTGCTAC No data
Right 1174094265 20:48075545-48075567 ACCACTGCCCTCATCTGCAGGGG No data
1174094253_1174094264 13 Left 1174094253 20:48075508-48075530 CCAGCACCTTCCATCCCTGCTAC No data
Right 1174094264 20:48075544-48075566 CACCACTGCCCTCATCTGCAGGG No data
1174094253_1174094263 12 Left 1174094253 20:48075508-48075530 CCAGCACCTTCCATCCCTGCTAC No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174094253 Original CRISPR GTAGCAGGGATGGAAGGTGC TGG (reversed) Intergenic
No off target data available for this crispr