ID: 1174094258

View in Genome Browser
Species Human (GRCh38)
Location 20:48075523-48075545
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174094258_1174094263 -3 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
1174094258_1174094265 -1 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094265 20:48075545-48075567 ACCACTGCCCTCATCTGCAGGGG No data
1174094258_1174094270 27 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094258_1174094269 26 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094269 20:48075572-48075594 AAATTCCTCCCTTGAGCTCATGG No data
1174094258_1174094264 -2 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094264 20:48075544-48075566 CACCACTGCCCTCATCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174094258 Original CRISPR TGGTGTGGCCGGGTAGTAGC AGG (reversed) Intergenic
No off target data available for this crispr