ID: 1174094262

View in Genome Browser
Species Human (GRCh38)
Location 20:48075543-48075565
Sequence CCTGCAGATGAGGGCAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174094262_1174094270 7 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094262_1174094275 16 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094275 20:48075582-48075604 CTTGAGCTCATGGGTGCAGTGGG No data
1174094262_1174094274 15 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094274 20:48075581-48075603 CCTTGAGCTCATGGGTGCAGTGG No data
1174094262_1174094276 17 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094276 20:48075583-48075605 TTGAGCTCATGGGTGCAGTGGGG No data
1174094262_1174094269 6 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094269 20:48075572-48075594 AAATTCCTCCCTTGAGCTCATGG No data
1174094262_1174094277 18 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094277 20:48075584-48075606 TGAGCTCATGGGTGCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174094262 Original CRISPR CCTGCAGATGAGGGCAGTGG TGG (reversed) Intergenic
No off target data available for this crispr