ID: 1174094263

View in Genome Browser
Species Human (GRCh38)
Location 20:48075543-48075565
Sequence CCACCACTGCCCTCATCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174094258_1174094263 -3 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
1174094254_1174094263 6 Left 1174094254 20:48075514-48075536 CCTTCCATCCCTGCTACTACCCG No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
1174094257_1174094263 -2 Left 1174094257 20:48075522-48075544 CCCTGCTACTACCCGGCCACACC No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
1174094256_1174094263 2 Left 1174094256 20:48075518-48075540 CCATCCCTGCTACTACCCGGCCA No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
1174094253_1174094263 12 Left 1174094253 20:48075508-48075530 CCAGCACCTTCCATCCCTGCTAC No data
Right 1174094263 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174094263 Original CRISPR CCACCACTGCCCTCATCTGC AGG Intergenic
No off target data available for this crispr