ID: 1174094270

View in Genome Browser
Species Human (GRCh38)
Location 20:48075573-48075595
Sequence AATTCCTCCCTTGAGCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174094262_1174094270 7 Left 1174094262 20:48075543-48075565 CCACCACTGCCCTCATCTGCAGG No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094260_1174094270 16 Left 1174094260 20:48075534-48075556 CCGGCCACACCACCACTGCCCTC No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094259_1174094270 17 Left 1174094259 20:48075533-48075555 CCCGGCCACACCACCACTGCCCT No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094268_1174094270 -3 Left 1174094268 20:48075553-48075575 CCTCATCTGCAGGGGAAGCAAAT No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094258_1174094270 27 Left 1174094258 20:48075523-48075545 CCTGCTACTACCCGGCCACACCA No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094261_1174094270 12 Left 1174094261 20:48075538-48075560 CCACACCACCACTGCCCTCATCT No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094257_1174094270 28 Left 1174094257 20:48075522-48075544 CCCTGCTACTACCCGGCCACACC No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094266_1174094270 4 Left 1174094266 20:48075546-48075568 CCACTGCCCTCATCTGCAGGGGA No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data
1174094267_1174094270 -2 Left 1174094267 20:48075552-48075574 CCCTCATCTGCAGGGGAAGCAAA No data
Right 1174094270 20:48075573-48075595 AATTCCTCCCTTGAGCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174094270 Original CRISPR AATTCCTCCCTTGAGCTCAT GGG Intergenic
No off target data available for this crispr