ID: 1174097903

View in Genome Browser
Species Human (GRCh38)
Location 20:48104120-48104142
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174097903_1174097910 7 Left 1174097903 20:48104120-48104142 CCAGATGTGAGAAATGTATGAGA No data
Right 1174097910 20:48104150-48104172 GAGGAGGGGTTGGTCTTTCTTGG No data
1174097903_1174097909 -3 Left 1174097903 20:48104120-48104142 CCAGATGTGAGAAATGTATGAGA No data
Right 1174097909 20:48104140-48104162 AGAGAGGAGAGAGGAGGGGTTGG No data
1174097903_1174097906 -9 Left 1174097903 20:48104120-48104142 CCAGATGTGAGAAATGTATGAGA No data
Right 1174097906 20:48104134-48104156 TGTATGAGAGAGGAGAGAGGAGG No data
1174097903_1174097907 -8 Left 1174097903 20:48104120-48104142 CCAGATGTGAGAAATGTATGAGA No data
Right 1174097907 20:48104135-48104157 GTATGAGAGAGGAGAGAGGAGGG No data
1174097903_1174097908 -7 Left 1174097903 20:48104120-48104142 CCAGATGTGAGAAATGTATGAGA No data
Right 1174097908 20:48104136-48104158 TATGAGAGAGGAGAGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174097903 Original CRISPR TCTCATACATTTCTCACATC TGG (reversed) Intergenic
No off target data available for this crispr