ID: 1174097906

View in Genome Browser
Species Human (GRCh38)
Location 20:48104134-48104156
Sequence TGTATGAGAGAGGAGAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174097903_1174097906 -9 Left 1174097903 20:48104120-48104142 CCAGATGTGAGAAATGTATGAGA No data
Right 1174097906 20:48104134-48104156 TGTATGAGAGAGGAGAGAGGAGG No data
1174097902_1174097906 1 Left 1174097902 20:48104110-48104132 CCAGGCAGTTCCAGATGTGAGAA No data
Right 1174097906 20:48104134-48104156 TGTATGAGAGAGGAGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174097906 Original CRISPR TGTATGAGAGAGGAGAGAGG AGG Intergenic
No off target data available for this crispr