ID: 1174098232

View in Genome Browser
Species Human (GRCh38)
Location 20:48106581-48106603
Sequence CTCCATATGTCAGTCATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174098232_1174098240 5 Left 1174098232 20:48106581-48106603 CCTGACATGACTGACATATGGAG No data
Right 1174098240 20:48106609-48106631 GGGCCATGAGCCAAGGAATGTGG 0: 46
1: 167
2: 266
3: 425
4: 782
1174098232_1174098241 6 Left 1174098232 20:48106581-48106603 CCTGACATGACTGACATATGGAG No data
Right 1174098241 20:48106610-48106632 GGCCATGAGCCAAGGAATGTGGG 0: 49
1: 238
2: 485
3: 882
4: 1297
1174098232_1174098243 9 Left 1174098232 20:48106581-48106603 CCTGACATGACTGACATATGGAG No data
Right 1174098243 20:48106613-48106635 CATGAGCCAAGGAATGTGGGTGG 0: 24
1: 56
2: 178
3: 362
4: 716
1174098232_1174098239 -2 Left 1174098232 20:48106581-48106603 CCTGACATGACTGACATATGGAG No data
Right 1174098239 20:48106602-48106624 AGGGAGGGGGCCATGAGCCAAGG No data
1174098232_1174098245 29 Left 1174098232 20:48106581-48106603 CCTGACATGACTGACATATGGAG No data
Right 1174098245 20:48106633-48106655 TGGCTCCTAGAAGCTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174098232 Original CRISPR CTCCATATGTCAGTCATGTC AGG (reversed) Intergenic
No off target data available for this crispr