ID: 1174099809

View in Genome Browser
Species Human (GRCh38)
Location 20:48118671-48118693
Sequence CAAGCTTTCTAGAGGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174099809_1174099815 5 Left 1174099809 20:48118671-48118693 CCAATTGCCCTCTAGAAAGCTTG No data
Right 1174099815 20:48118699-48118721 ATTAACTCACACAAGAGGTGGGG No data
1174099809_1174099812 0 Left 1174099809 20:48118671-48118693 CCAATTGCCCTCTAGAAAGCTTG No data
Right 1174099812 20:48118694-48118716 TACTAATTAACTCACACAAGAGG No data
1174099809_1174099814 4 Left 1174099809 20:48118671-48118693 CCAATTGCCCTCTAGAAAGCTTG No data
Right 1174099814 20:48118698-48118720 AATTAACTCACACAAGAGGTGGG No data
1174099809_1174099813 3 Left 1174099809 20:48118671-48118693 CCAATTGCCCTCTAGAAAGCTTG No data
Right 1174099813 20:48118697-48118719 TAATTAACTCACACAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174099809 Original CRISPR CAAGCTTTCTAGAGGGCAAT TGG (reversed) Intergenic
No off target data available for this crispr