ID: 1174100495

View in Genome Browser
Species Human (GRCh38)
Location 20:48123065-48123087
Sequence CTGTGTTAGTTGAAGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1174100495_1174100502 10 Left 1174100495 20:48123065-48123087 CCCTCAAACTTCAACTAACACAG No data
Right 1174100502 20:48123098-48123120 CCACAGTTAAACAGCAGCACGGG No data
1174100495_1174100500 9 Left 1174100495 20:48123065-48123087 CCCTCAAACTTCAACTAACACAG No data
Right 1174100500 20:48123097-48123119 CCCACAGTTAAACAGCAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1174100495 Original CRISPR CTGTGTTAGTTGAAGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr